Mireles, Gustavo Lopez (Tex. App. 2015). · Go Syfert
Mireles, Gustavo Lopez (Tex. App. 2015). Book View Copy Cite
No syfertize treatment data for cluster 4275992.
Mireles, Gustavo Lopez
WR-76,258-03.
Court of Appeals of Texas.
Mar 19, 2015.
Published

GUSTAVO L. MIRELES 3001 S. EMILY DR. McCONNELL UNIT BEEVILLE, TEXAS 78102

March 14, 2015

Texas Court of Criminal Appeals Attn: Hon. Abel Acosta (Clerk) P.O. Box 12308 Capitol Station Austin, Texas 78711

Dear Clerk: If you could would you please be so kind and file this Application for Writ of Mandamus in the appropiate court. If this application is not properly addressed, can you please be so kind and notify me and/or return the application with instructions to correct the error. Thank you for your time and attention to this very important and urgent matter. Please notify me when filed. Sincerly,

/s~ra/xwa il- flll,Mkz Gus~vo L. Mireles

ENCLOSURES: CC: File, Leonor Matano 580 Irene Dr., canyon-Lake, Texas 78133; she has "power of attorney•.

This document contains some pages ~hat are of poor quality at the t1me of imaging. i \

[*1]

l MOTION FOR LEAVE IN THE COURT OF CRIMINAL APPEALS OF TEXAS AT AUSTIN, TEXAS GUSTAVO LOPEZ MIRELES § APPLICANT § Vs. § NO~---------------------- HIDALGO COUNTY DISTRICT ATTORNEY§ This document contains some OFFICE, RENE GUERRA, AND THE § pages that are of pooli' qMaRn~ McALLEN TEXAS DEPARTMENT OF at the time of imagililQJ. ·· PUBLIC SAFETY DNA CRIME FIELD LABORATORY SEROLOGIST ORLANDO § OCHOA, 139TH DISTRICT COURT JUDGE BOBBY FLORES RESPONDENTS § Motion for Leave to File J.tpplication For WRIT OF MANDAMUS TO THE COURT OF CRIMINAL APPEALS OF TEXAS: NOW COMES, Gustavo Lopez Mireles, applicant, complaining of, District Attorney Rene Guerra, and Serologist Orlando Ochoa, respondents and pursuant to Rule 52.1 of the Texas Rules of Appellate Procedure (former Rule 211) in Cri~ inal Cas~s, moves this court to grant leave to file this application for a writ of mandamus tendered contenpuraneously with this motion. Applicant prays that the Motion be gran~ed, the said application for Mandamus be filed and set down for a hearing, that the relief requested be granl:~d, general and special, including a stay of proceedings below until the matters ,; .. t ~l complained of in said atppl ication are,\cured. Res~ec::uly Submitted /s/_ gQ~ (11~ J. Applicant Pro-se Gustavo L. Mireles TDCJ-ID #1128895 3001 S. Emily Dr. McConnell unit Beeville, Texas 78102 CERTIFICATE OF SERVICE I hearby certify that a copy of the above Motion for Leave to file application for Wri t of Mandamus was d)=iliver~e,d pr mailed to Respondent at Responden.t•'s adress, on this /Ji"':~-~-20<14.

/s/ ~-of~~~ ··Apllicant Pro-se

IN THE COURT OF CRIMINAL APPEALS OF TEXAS AT AUSTIN TEXAS

GUSTAVO LOPEZ MIRELES § APPLICANT

Vs . § NO-------------------------- HIDALGO COUNTY DISTRICT ATTORNEY~ OFFICE, RENE GUERRA, AND THE § McALLEN, TEXAS DEPARTMENT OF PUBLIC SAFETY DNA CRIME FIELD ':'

LABORATORY SEROLOGIST, ORLANDO OCHOA, !39TH DISTRICT COURT § JUDGE BOBBY ~ ··.rr. . . FLORES ~ r"\ " - .. ': ~-- ..

..,l~E·s J? b'NnE'N Ts § . •

APPLICATION FOR MANDAMUS TO THE HONORABLE COURT OF CRIMNAL APPEALS OF TEXAS: NOW COMES, Gustavo Lope~ Mireles, applicant, and asks this court to issue a Writ of Mandamus to Hidalgo County Texas District Attorney.!.<:;:; .~OJ f't&:t?... ··:, and McAllen, Texas Department of Public Safety DNA Cri~e Field Laboratory serologist, Orlando Ochoa, respondents, to require respondent describe relief requested and in support of this application would show this court the following; concerning Motion for Court of Inquiry and motion for Diclosure. I . FACTUAL BACKGROUND Applicant filed a ~otion to conduct a Court of Inquiry on June 10, 2014. The motion was denied due to lack of substancial facts to establish probable cause for conducting a ~ourt of Inquiry on August 14, 2014. (See attach-ed Exhibit-A).A.ppl:Lca.nt's motion consists of overwhelming substancial facts that in the "Intrest of Justice" establish "'Probable Cause", to Conduct the Court of Inquiry requested, .in Trial Cause No. CR-3196-01-F. (a) The Legislature of Texas in April 1, 2001, enacted laws to govern all Texas Department of Public Saf~lty DNA Crlime FieB'J Laboratories analytical standards for quality assurance and! proficency testing for forensic DNA analysis on c~imlbal cas~s. l (b) The Texas Department of Public Safety DNA database must and had to be compatible with the national identification index system (COOlS) used by the FBI to the extent required by the FBI to permit the useful exchange and storage of DNA records or information derived from those records. (c) The Texas Department of Public·safety Crime Field Laborato- ries were required by Texas Lagislative Law, to establish stand~ ards for DNA analysis by any of it's DNA laboratories that meet or exceeded the quality assurance standards issued by the FBI. (d) If this quality assurance standards were not met, the director of the laboratory in violation of these standards as established by Le~iiative Law, was obligated to prohibit the laboratory from exchanging DNA records or analysis with another DNA laboratory or criminal juestice or law enforcement agency. (e) The record shows this honorable court, that the quality assurance standards when testing DNA forensic analysis, issued by the FBI were not met or exceeded, in this instant case. The standards utilized by the McAllen Department~of Public Safety DNA Crime Field laboratory and it's serologi~\Olando ochoa, did not even come close to the standards issued by the FBI. (f) The offnese charged to the Appellant of First Degree Murder, had not even taken place yet. The appellant was charged with the offense by indictment to have been commited on or about'"'- ··~:r::; ~~: · June 23, 2001, 8 moths after the Texas Legislature enacted these DNA analytical mthodology standards, and they're requirments. (g) Appellant was entiltled by due process constitutional right the right to have these Texas Laws applied to the DNA analysis of this instant case. (Trial Cause No. CR-3196-01-F). (h) Every agency that is established in the State of Texas, must abide by Texas Laws. If any agency violates this Laws and causes harm to another in the process, that agency commits a crime against the State of Texas; pursuant to the Texas Penal code. (2) Denial to conduct the Court of Inquiry was recived from the !39th district court on August 22, 2014, through TDCJ McConnell Unitm, 3001 s. Emily Dr., Beeville, Texas, Mail room service. Appellant's motion to conduct the Court of Inquiry was not addressed to be filed in the !39th district court, but instead to the 206th district court, where judge Rose Guerra Reyna is the presiding judge. (see attached exhibit-A). Appellate Clerk Alexandra Gomes, took it upon herself, in violation of the TCCP. Art. 2.21, and filed the motion in the 332nd district court, where accussed defendant Mario Ramirez Jr. presides. dfter the I App;ll''-'.::ant inquired of the motion's desposition, through the ap~~Jiant's sister, Leonor Matano, 580 Irene Dr. Canyon-Lake, Tx.

[*2]

I I. REQUEST FOR RELIEF

Applicant asks this Honorable court to issue a Cdurt Order pursuant to this PMinistrial Act", for the Court of Inquiry to

be co~ducted. Cr~es have been committed against the State of Texas and against the applicant, by the Responden:..tl 's failure to uphold i:.he laws enacted by the States Legislature.

I II. J!JRI SPI CTION This court has jurisdiction to consider this application

pursuant to Art. 5,5 of the Texas Constitution and Art. 4.04 of the Code of Criminal Procedure; to include Art. 1~04,1.05.

IV. AUTHORITIES AND ARGUMENT

On December 12, 2001 State's Forensic expert, serolog~st

Orlando Ochoa of the McAllen, Texas D.P.S. Crime Field Laboratory conducted a DNA analysis concerning the Capitol Murder of victim r1ary Jane Rebollar; and COL\ paring the DNA left behind at the . it cx:lime scene to the Applicant's DNA sample. Analyst Orlando Ochoa on August 6, 2001, testified at trial 332nd district court; that

for a basis for his DNA analysis of the case he had used the Co~bined DNA Index System (coors), na~ional DNA database computer system. (See attached exhibit-B1RR. Vol 9. pgs 20-21).

The DNA Database System that state expert analyst Orlando

Ochoa was refering to was the DNA Database System in SUBCHAPTER

G. of the Executive Brabch DepartBent of Public Safety Title 4

Ch. 411. By analyst Orlando Ochoa, utilizing the coors DNA

Database System to conduct the DNA analysis of this case, he was obligated and required pursuant to section § 411.142 (a) through (h) to conduct the DNA analysis to either meet or exceed the current standards for quality assurance 'I and proficiency testing for fore~sic DNA analysis issued by the Federal Bureau of Investigation, (FBI), (See attached exhibit B-2)

[*3]

Orlando Ochoa, was further required to ensure that the DNA database was compatible with the national DNA iden.t)ification

index system (CODIS) or Combined DNA Index System; used by the FBI to the extent required by the FBI to permit the useful exchange and storage of DNA records or information derived from those re~ords, concerning the investigation of a crime, regard·-

1 e s s o f or g i n , ( See at t a c he d ex h i b i t -B-l .a t. (b ) ( f ) ( g ) (h ), This subchapter G. of the DNA Database system was Added by Acts of 1995, 74th Legislature Ch. 595, § 1. eff. Sept 1, 1995.

Amended by Acts 2001, 77th Leg. Ch. 2, § 4, eff. April 5, 2001.

Orlando Ochoa conducted the DNA an~lysis in this instant case in December 12, 2001, eight months after the Legislature enacted this laws. The DNA analysis in this instant case were subject

to these requirments, set by the FBI CODIS, In order to meet or exceed the FBI's quality assurance and proficiency DNA testing for forensic DNA analysis, the DNA

protocols and standard operating procedures require a finding and search at a minimum of 13 defrent loci, from the crime scene DNA samples to a suspect's DNA sample. This 13 Core coors loci search

and match must be met, in order for Orlando Ochoa to conclude and testify at trial that he had made a, ,. Consistant Match", a

''Source attribution Match", a Positive Match", a "Randum Match

Probability: However, Orlando Ochoa testified under oath at trial that he only searched for 9 loci, and compared only 9 loci

from the c~ime scene DNA to the appellant's DNA sample, Further, he testified that he had only been able to match 2 to 3 loci from both samples, when conducting the analysis.(See attached exhibit-~~pgs 23-24)• .Orlando Ocho~, further testified that concerning skin samples, blood, that had been embedded underneath the victim's

[*4]

Mary Jane Rebollar 1 s fingernails, that because he had managed to match 2 loci,i he told the jury, that this DNA belonged to

~he victim, instead of some other person. (See attached exhibit-&f

pgs 25-26), The Appellant was excluded as being the contributor to that DNA, Orlando Ochoa knew about the 13 COOlS core loci

requirment, because he testified that it was not uncommon for DNA analyst to look at the 13 regions to make it more specific to an individual. (See attched exhibit-&1-at pg 32). It didn't matter to Orlando Ochoa, if he was complying with the DNA data- base requirments or not 1 if he matched only 2 loci, to him it was a match, and that was that. (See attached exhibit-&1at pg

34~35). It is clear and convincing that Orlando Ochoa knew about the requirments set forth qy the FBI which require a match of 13 diffrent loci from the crime scene DNA to the appellant's

DNA sample, in order to testify that he made a match. It is clear and convincing that Ochoa, choose not to follow standard operating procedures. He utilized the DNA Database System, but instead of following protocol, set his own DNA analytical guidelines in violation of legislative laws.

(4) Due to the reasons stated above, the appellant further contested in his motion that Orlando Ochoa had committed crimes

against the state of Texas. (1) Aggravated Perjury Texas Penal Code § 37.03, (2) False Report to a Peace Officer or Law Enforce- ment agency, Texas Penal Code §37.08) (3) Tampering Wither

Fabricating Physical Evidence, Texas Penal Code§ 37.09. (a), (1) (2).

[*5]

--.

(4) Tampering With a Goverment Record, Texas Penal code § 37.10, (a) (l) (2) (3) (4) (5) (6), Orlando Ochoa, committed

such crimes against the state of Texas when he .knowingly made the false entry and alteration of a goverment record, when he submitted as reliable evidence his DNA analysis of this instant case, ~nowing that it was fruadulent, and misleading. He further

knew that his DNA analysis did not meet or exceed the FBI's coors national Inde~ system's quality assurance and proficiency DNA testing forensic standards, but he still choose to testify at trial that his analysis were true and correct. Ochoa's trial testimo~y and DNA test results are the only evidence that the state relied upon to obtain this instant conviction.

The McAllen Texas DPS Crime Field Laboratory, and it's directors

Thomas A, Davis jr., Frankie Waller, .and David Mceathron, · klnew or should have known befor_kl authorizing .!.he ::Jkllease of this fruadulant, incriminating, DNA test r~bults, conducted by Orlando ochoa, were fruadulent, misleading, and not in compliance with

CODIS FBI's standard Operating procedures. By allowing the exchange of these records, they all became acomplices, of said crimes against the state of Texas pu~suant to Texas Penal Code

§ 43 .06. (a) (b) (c) (d).

District Attorney Rene Guerra and trial Judge ~ario Ramire~

Jr, committed the offense of Abuse of Official Capacity, pursuant to the Texas P e n a l code . § 3 9 . 0 2 . and § 3 9 , 0 3 , ( a ) ( l ) ·t 2 ) , Bo t: h

District Attorney Rene ijuerra and Mario Ramirez Jr, trial judg~ should have ~nown as a matter of la~ when hearing Orlando Ochoa's .! fruadulan~ and delibrate misleading DNA test result's testimon~

[*6]

that his DN~ test result's wer~l inadmissable pursuant to the Texas Legislature's enactted laws. Both of them, failed to act, and instead allowed the appellant Gustavo L, Mireles to be convicted soley on this DNA test results provided by Orlando

Ochoa, the State's "Hired Gun'~ Appelant was convicted to Life in prison, based on fruadulent, faulty, unreliable, unacceptable by the forensic science community then when the tests were conducted in Dec 12, 2001 or now, "Junk Science". (See attached exhibi t~:G,;.-~ Newly acquired evidence),.

(4) LACK OF JURISDICTION TO ENTER RULING;

Judge Bobby Flores of the 139th District court of Hidalgo

County, Texas , when he first recived this motion, through

"Tootsie", secretary of judge Mario Ramires J~, at the 332nd

criminal district court, on or about August 3,2014, review and entertained said motion, and decided to submitt said motion Lo administrative judicial district judge Rolando Olvera. Pursuant to the Texas Code of Criminal Procedure Art 52.01 (a), judge

Flores in order to submitt the motion LO judge Olvera, had to first belive that the motion consisted of "probabl.e= Cause" that a crime against the state of Texas had been committed.

The decision of judge Bobby Flores to request and submitt the motion Lo Rolando Olvera, implicate~ substancial facts had been establ~ hed for requesting judge Olvera to asign a judge to commence the Court of Inquiry. Administrative judicial judge

Rolando Olvera, returned the motion back to judge Bobby Flores, on or about August 11, 2014~ Pursuani to the TCC~ Art. 52.01. the fact that this instant motion was entertained by the administrative judicial district judg~ iMplicated that by him rec i vi ng the mot ion and submitting i.il back to judge ''Bobby"

[*7]

Flores, was for the judge Bobby Flores ~o comence the Court of Inquiry, and not ~o order that the COurt of Inquiry not be conducted; as he did in his court order ruling issued in Aqgust

14, 2014. Furthermore, judge Flores lacked jurisdiction to enter a ruling pursuant to Texas Code Cri~inal procedure Article

52.01 (b) (2), because he was the requesting judge.

It was District Attorney Rene Guerra himself that opened the "Gateway" to this Court of Inquiry. In March 15, 2004, Rene

Guerra was notified that an audit conducted by the Department of Public Safety cited the McAllen, Texas Crim~kField Laboratory with numerous DNA analytical policies and procedural problems.

The audit caused the Laboratory's closure. The laboratory had

been using outdated Standard Operating Procedures, then the ones currently adopted by the Texas Legislature. The laboratory's director c la icr,ed that they were given permission, because they· were "Grand..fla. the red". ReneGuerra said that the De par tmen t of ·. ''·

Public Safety had to itemize the cases that had been effected by the laboratory's closure. Especially the cases where DNA had playetl a .major role in the state obtaining a conviction. More then 300 cases had to be re-evaluated. (See attached exhibit

B-4). Because the DNA evidence was the only evidence that the state had relied upon lb obtain l~e conviction in cause No.

CR-3196-01-F; Applicant had and has a constitutional right to be notified if his case was within the 300 cases that were re-evaluated. Furthermore, .what analytical DNA forensic analysis procedures were utilized in ihe re-evaluation process. Applicanil

has motioned the district attorney's office for disclosure of said issue and that motion has also been denied. (See attached exhibit A.-5) .

[*8]

Bo·th motion to conduct a "Court of Inquiry" and 'motion for Disclosure", have been appealed to the 13TH court of Appeals.

(see attached exhibit B-5). In the motion to aonduct a court of Inquiry, the Court of Appeals has entered an Opinion and judge- ment saying that,"AAparty may appeal only that which the Texas

Legislature has authorize~!". Further saying that, "TCCP. Art.

Ch. 52 does not provide for an appeal to a district judges determination in a motion to conduct a Court of Inquiry. Both

deci~ions from the Court of Appeals are erronious because: A. the court has decided an important question of State and ' federal law th~t has not been, but should be settled by the Court of Criminal Appeals. B. The court has decide:rl 1 an important question of State and i Federal Law in a way that conflicts with the applicable d.eqisi-'61)9 of the Texas Legislature's laws that govern the land. C. the court has declared a statute, rule, and ordiance to in the "Intrest of Justice" revie.U, be unconstitutional, and appears to have overlooked the statutes under the "color of law". D. The justices of the Court of .Appeals have disagreed in a material question of law necessary to the court's d~cision . .:~U ' F. The court of appeals has ~part~ from the accepted and usual coarse of judic~~l proceedings and has sanctione~ such a departure by a lower.court, which calls an exert~se of the Court of Criminal Appeals' power of supervision.

Applicant asserts that the Texas Leg isla ture, (like argued ) '' priorly, authorized in April 5, 2001, that all Texas DPS Crime

Field laboratories utilize quality assurance DNA testing standard that either ,,nneet or exceed the FBI's Combined DNA Index .Sjstem issued by the FBI. The court of Appeals has dismissed the motion to conduct a Court· of Inquiry sayi~ that the applicant could

only appeal "that which Texas Legislature has authorized''. Well, the motion, contested that the state di~ not apply to this instant case, CR-3196-01-F State of Texas vs. Gustavo L .. Mireles the DNA analitical standards authorized! by the Texas Legislatuie 1 therefor, making tlhe issue appealable. Furthermore, nowhere in the Texas code of Criminal Procedur~ Chapter 52, d6es it state that a district judge's determination on a motion to conduct a

[*9]

Court of Inquiry, is not appea!~/:j/i!!J- (See TCCP. 2012 Ed.).

~he Court of Appeals ruled that all other motions pending were dismissed as moot. This without even looking at the motion for Discloi~re, which consisted bf a diffrent issue which was also of constitutional magnatude.

Not only does the Court of Appeals decision viol a tes and ill contridictor~ to the State of Texas en~cted legislative laws, but it also violates the United States constitutional Amendments 5th 1 6th and 14fh due process clause. This violations rise to a funda~ mental defect which inherently r~~ults in a complet~ miscarriage

of justice and is inconsistent with the r6!dimentary illemands of fair procedure.(See, Cockerham v. Cain, 283 F. 3d 657/663 (5th

Cir. 2002).

The dismissal iQ both the district court and the court of appeals opinions and judgements, are actions done under

col or of law, which are done with the appa r~lnt authority of the law, but actually in contrevention of the law. A Federal Cause of action may be maintaned against a state officer who under color of law deprives a person of his civil rights. 42 u.s.c. §1983.

The matters and issues presented to both courts are so

"Plain" that the errors are "cl~lar" and "obvious" and a·ffect the applicant's substantial rights; this errors seriously affect fairness, integrity and public reputation of the judicial

proceedings. (See u.s. v.Kirk, 528 F. 3d 1102, 1110 (8th Cir. 0 '· 2008), (See also, FED. R. CRIM. P. 52 (b).)

[*10]

In both cases Court of Inquiry motion, and motion for Disclosure, the records clearly show that the Respondents/or Defendants never filed any type of response or refuted the assertions and alligations contained therein. Pro-se alligations

are accepted as true, unless they are clearly frivolous.(see, United States v. Baynes, 622 F. 2d 66 (3rd Cir. 1980). Further- more, when the State fails to despute the facts contained in a

Petitioner's pro-se alligations, it essentially admits those alligations. tsee, Bland v. Dept. of Corrections, 20 F.3d 1469

(9th Cir. 1994), See also, In··re Sixto,48 Cal. 3d 1247, 259 Cal.

Rptr 491,492, 774 P. 2d 164, 165 (1989), See also, Earp v. Stokes, 423 F. 3d 1024 (9th Cir. 2005). The Applicant/Petitioner has shown to this Honorable Court a 'Colorable Claim• where he has alleged specific facts that are true, which entitle him to

relief, unless the alligations are clearly frivolous. See, Morre v. United states, 571 F~ 2d 179, 184 (3d Cir. 1978).

The Applicant/Petitioner has presented to this Honorable

Court compelling evidence that substanciates that Crimes against the State of Texas have been clearly comitted. The Supreme

Court has held in ''Brady" that the supression by the prosecution of evidence favorable to an accused upon request violates due process where the evidence is material either to guilt or to

punishment, irrespective of the good faith or bad faith of the prosecution". 373 U.S. at 87. there after the Court held that such disclosur~ is mandatory regardless of whether a defendant

requests it, United States v. Ag~rs, 427 u.s. 97, 107 (1976), and that impeachmnet eviden~e must also be disclosed, see Brady

473 u.s. at 676; Giglio, 405 u.s. at 154. ll

Applicant has obtained "newly Discovered Evidence" in the form of two highly qualified forensic analysts who are expert in the forensic field, Hary j. Bonell M.D. and John Plunkett M.D.

have both provided affidavit and a letter substanciating that the DNA analysis conducted by state analyst Orlando Ochoa in December

12, 2001 were def~btive and misleadlbg and below the acceptable forensic .community standards, then and now. (See Exhibit-B-6). v. CONCLUSION

(l) Applicant has no legal remedy available to him other then this application f.l:lr writ of manda,mus. (2) This action sought, under the facts of this case, in essence, a ministrial act which respondent had legal duty to preform. (3) Appllkant has properly requested repondent to preform, which repondent has refused. WHEREFOR, PREMISSIS CONSIDERED, Applicant prays that this

application be granted and that the reMponden~ be ordered ib continue with the relief requested. Respectfuly Submitted,

Is I lJw/NIJ J_ &Rh Aplicant Pro-se Gustavo L. Mireles TDCJ-ID #1128895 3001 s. Emily 1 IDr. McConnell Unlt Beeville, Texas 78102

INMATE DECLARATION I, Gustavo L. Mireles, presently incarcerated at the Texas Department of Cri,, inal Justice Division, McConnell Unit, located at 3001 S. Emily. Dr , Beeville, Texas 78102, have carefuly read the foregoing insturmelad'land :find- same to be tr.ule and correct, in all things therein, to the best of ..myl ,knowledge. S i g ned t his .-l"f. ii a y o f . ~-~ ;-c l;i; ':: ::- ., 2 0 l 4 Respectfuly Submitted,

/s 1- /atLJko? r/- Ltfvidt Applicant Pro-se Gustavo L. Mireles

EHIBIT A CONSISTS OF:

1. Motion to conduct a court of Inquiry fliled by the Hidalgo county Clerk's office; June 10, 2014

2. Court Order issued by 139th District court, presiding judge Bobby ~ores. 3. Amanda and M3cario Mireles's Texas General Affidavits, concerning the procedures taken in the instant motion as having personally been told to them by Alexandra Gomez, "Tootsie", and "Shila, secratary of the 139th district court 4 Leonor Matano's Texas General Affidavit, concerning the procedures taken in the instant motion, as told to her on and through telephone records, by Alexandra Gomez, 'Tootsie" and 'Shila, the secratary for the 139th district court.

5. Motion for Disclosure filed May 30, 2014.

AFFIDAVIT OF AMANDA MIRELES

STATE OF TEXAS § § COUNTY OF HIDALGO §

Before me, the undersigned authority, on this day personally appeared affiant Amanda Mireles, who proved to me to be the person whose name is subscribed to this Affidavit and who acknowledged to me that she executed the same, and after she was duly sworn, upon her oath, she deposed and said:

My name is Amanda Mireles. I am 76 years of age, of sound mind and capable of making this affidavit. The facts stated in this affidavit are within my personal knowledge and are true and correct.

On June 10, 2014, I went to the Hidalgo County District Clerk's office and I spoke to Sandra Gomez. I took her some documents that were to be delivered to Judge Rose Guerra Reyna. Sandra took those documents to her supervisor, Laura Hinojosa, and then the documents were sent to Judge Mario Ramirez. I specifically told Sandra that the papers were not for Judge Ramirez but rather for Judge Guerra Reyna because my son, Gustavo Mireles wanted for me to deliver them to Judge Guerra Reyna. Sandra took the papers to Judge Ramirez' office. A few days passed and they sent the papers to Judge Bobby Flores. Judge Flores' secretary reviewed the papers and then were sent to Cameron County and Judge Rolando Olvera. A few days later, the secretary told me that Judge Olvera returned the papers to Judge Bobby Flores, who was to make a decision on the documents.

SWORN TO and SUBSCRIBED before me by Amanda Mireles on this 29th day of August 2014. NOTARY PUBLIC Notary Public in and for the State of Texas Rick Puente My Commission Expires on State of Texas November 12, 2014. i 1 Rick Puente-Notary Public: PO Box 1514, San Juan, TX 78589 (956) 782-8425 I August 13, 2014 Innocence Project of Texas 1511 Texas Avenue · Lubbock, Texas 79401 RE: Gustavo L. Mireles Request for Criminal Inquiry filed Hidalgo CO. Courthouse on 7/10/14 Dear Nick or Attorney Jeff Blackburn, Enclosed is a copy of the Inquiry filed by Gustavo. As you can see it was addressed to Judge Rosa Guerra-Reyna. When I called the courthouse for status, they informed they did not know what to do with it. The last inquiry they received was 30 years old. The Trial Judge Ramirez had it, and then transferred to Judge Guerra-Reyna. She did not know what to do so she forward it to her superior Judge Roberto "Bobby" Flores. Judge Flores sent it to District 5 Judge, Rolando Olvera whom sent it back to Judge Flores to process and address. The inquiry has several elements, one the elements (DNA report and results) submitted to Jury was a "material misrepresentation", and such representation would induce a Juror or a reasonable person to alter the outcome of the verdict. Second this was "false representation" of the DNA. Third, misrepresentations were made knowing and recklessly with the intent. Fourth the trial Judge keeper of Justice and the DA knew the representation was false, made recklessly, as positive assertions, and without knowledge of the truth to Jury and were made with the intent to mislead the Jury and the outcome of the verdict, a criminal offence was committed. This is not common in this county. Keep in mind, 5 sheriffs from the Rio Grande Valley including the Hidalgo Co. sheriff were convicted of criminal charges and some are serving prison sentences. As recent as a few months ago the Hidalgo Sherriff, his son (Leader of the Panama unit) and several of his top officials were indicated and are serving prison terms including a DA whom was helping them and there were many more. We relied on the truth and they kept it from the Jury. If the Inquiry results in a hearing, will you help us by representing Gustavo? Please let mei)no so we can prepare. Thank you, Leonor Mata Cc: Gustavo L. Mireles Enclosures SYLVIA REYES CouRT CooRDINATOR )39TH JUDICIAL DISTRICT OF TEXAS I 00 N. Closner, 2nd Floor Tel: (956) 318-2260 Edinburg, TX 78539 Fax: (956) 383-7608 . ---- --- ... - ' _____ __ ,.. ""'--~- .. -- -- ------ . - sylvia [email protected] . 3\ ...-~-···· ·- ...0. - '") U ... ··-·····~ 2LD. - ·-Q .......... .............. ... ------.--··--··· ___ ....,. _______ , .. ····•···· .. ····----2~ . . . £_\Q.O( . . . . . . . . . . J.R. "Bobby" Flores Judge, I 39th State District Court .~pmyDiStrje~. Hidalgo County Courthouse I 00 North Closncr, Second Floor Edinburg, Texas Tel: (956) 318-2260 c. R- ;;: !;; () - {? I . ~ ~2. hi· PO Box 87 Tel. (956) 3 1 Edinburg, Texas 78540 Fax (956) 3: Email: [email protected] Case No. CR-3196-0 1-F STATE OF TEXAS § IN THE 139TH DISTRICT COURT § § § vs. § OF § § § GUSTAVO LOPEZ MIRELES § HIDALGO COUNTY, TEXAS ORDER. ~ .. • ,.. On this the 14th day of August, 2014, the Court having examined the pleadings, record, and the submitted transcripts, FINDS that there is lack of substantial facts to establish probable cause for conducting a Court of Inquiry. IT IS THEREFORE ORDERED that a Court oflnquiry not be conducted SIGNED AND ENTERED on this the 14th day of August, 2014 ~ruDGE CHIEF JUSTICE NUECES COUNTY COURTHOUSE ROGELIO VALDEZ 901 LEOPARD, 10TH FLOOR CORPUS CHRISTl, TEXAS 78401 JUSTICES 361-888-0416 (TEL) NELDA V. RODRIGUEZ 361-888-0794 (FAX) DORI CONTRERAS GARZA GINA M. BENAVIDES HIDALGO COUNTY ADMINISTRATION BLDG. ~ourt of ~peals GREGORY T. PERKES NORA L. LONGORIA 100 E. CANO, 5TH FLOOR EDINBURG, TEXAS 78539 CLERK 956-318-2405 (TEL) DORIAN E. RAMIREZ '(Ebfrttentb Jefstrftt of tn:exas 956-318-2403 (FAX) October 09, 2014 Hon. Oscar Rene Flores Hon. Rene A. Guerra Attorney at Law Criminal District Attorney 1308 South 1Oth Ave. Hidalgo County Courthouse Edinburg, TX 78539 100 N. Closner, Room 303 *DELIVERED VIA E-MAIL* Edinburg, TX 78539 *DELIVERED VIA E-MAIL* Re: Cause No. 13-14-00497-CR Tr.Ct.No. CR-3196-01-F Style.: Gustavo Lopez Mireles v. The State of Texas Encl_osed please find the opinion and judgment issued by the Court on this date. Very truly yours, ~C(,M- 5. ~~ Dorian E. Ramirez, Clerk DER:dsr En c. cc: 139th District Court/Hidalgo County (DELIVERED VIA E-MAIL) Hon. Laura Hinojosa, District Clerk (DELIVERED VIA E-MAIL) Hon. J. Rolando Olvera Jr., Presiding Judge, 5th Administrative Judicial Region (DELIVERED VIA E-MAIL) Case No. 13-14-00497-CR Page 2 Very truly yours, ?Su\~ 5. ~~ Dorian E. Ramirez, Clerk DER:sc cc: Hon. Rene A. Guerra (DELIVERED VIA E-MAIL) Hon. Laura Hinojosa, District Clerk (DELIVERED VIA E-MAIL) Mr. Jessie Salazar, Court Reporter NUMBER 13-14-00497-CR COURT OF APPEALS ' ' THIRTEENTH DISTRICT OF TEXAS CORPUS CHRISTl • EDINBURG GUSTAVO LOPEZ MIRELES, Appellant, v. THE STATE OF TEXAS, Appellee. On Appeal from the 139th District Court · of Hidalgo County, Texas. MEMORANDUM OPINION · Before Chief Justice Valdez and Justices Garza and Longoria Memorandum Opinion Per Curiam Appellant, Gustavo Lopez Mireles, attempts to appeal an order issued on August 14, 2014, denying his request for a court of inquiry. We dismiss the appeal for lack of jurisdiction. . -, ~ ~ . - jo: -A court of inquiry is a criminal proceeding authorized by and conducted according to Chapter 52 of the Texas Code of Criminal Procedure. See TEX. CODE CRIM. PROC. arts. 52.01-.09. When a district judge, acting in his capacity as magistrate, has probable cause to believe that an offense has b~en committed against the laws of this state, he or she may request that the· presiding judge of the administrative judicial district appoint a district judge to commence a court of inquiry. TEX. CODE CRIM. PROC. art. 52.01 (a). The appointed judge may summon and examine any witness in relation to the offense in accordance with the procedural rules established in Chapter 52. /d. If it appears from a· court of inquiry that an offense has been committed, the judge shall issue a warrant for the arrest of the offender as if the complaint had been made and filed. TEX. CODE CRIM. PROC. art. 52.08. A party may appeal only that which the Legislature has authorized. 0/owosuko v. State, 826 S.W.2d 940, 941 (Tex. Crim. App. 199_2); McCarver v. State, 257 S.W.3d 512 (Tex. App._:_ Texarkana 2008, no pet.). Chapter 52 does not provide for an appeal from the judge's determination. In re Court of Inquiry, 148 S.W.3d 554, 555 (Tex. App.-EI Paso 2004, no pet.). Accordingly, this appeal is DISMISSED for lack of jurisdiction. All pending motions are DISMISSED as moot. PER CURIAM Do not publish. TEX. R. APP. P. 47.2(b). Delivered and filed the 9th day of October, 2014.

. GUSTAVO L. MIRELES TDCJ-ID # 1128895 3001 S,. EMILY. DR. McCONNELL UNIT BEEVILLE, TEXAS 78102

June 16, 2014 FILED AT_ _ _O'CLOC~<_M Honorable District Clerk of Hidalgo county Texas JUN 1 0 2014 Attn; Laura Hinojosa 1ST FLOOR COURTHOUSE S ERK 100 N. CLOSNER BLVD. -go county P.O. DRAWER 87 EDINBURG, TEXAS 78540-0087 By--+-~-.,.'--t'-Depu~#44

Dear Clerk: If you could would you please be so kind an ~le this 'Motion To conduct A Court of Inquiry" at the 206TH Criminal District Court, judge Rose Guerra Reyna Presiding. This motion is sent to you for filing under the Texas Code of Criminal Procedure Article 2.21. (a) (1) (2) (3), please comply and if so kindly notify me when this legal documentation is filed. The Motion is filed pursuant to the Texas Code of Criminal Procedure Article 52.01- Thank you for your time and attention to this very important and urgent matter. Sincerly,

/sL/4~n J.(/l~ GUSTAVO L. MIRELES

ENCLOSURES: CC: Amanda Mireles, 1231 S. 3rd. St. , Alamo, Texas 78516 (956) 702-1044; Leonor Matano 580 Irene dr- canyon-lake, Texas 78102 (512) 787-1180; Florestella Limon, 103 Cottonwood, Donna, Texas 78537.

COURT OF INQUIRY Cause No=----------------~- AT FI£ED Pro-Se § IN THE 206TH CRIMINAL - 'CLOCK__ COMPLAINT ANT JUN 10 2014 GUSTAVO L. MIRELES DISTRICT COURT, JUDGE - - - - - § H/NQ v ROSE GUERRA HIDALGO COUNTY DISTRICT ATTORNEY"S OFFICE § HIDALGO COU RENE GUERRA AND McALLEN, TEXAS DEPARTMENT OF § PUBLIC SAFETY DNA CRIME FIELD LABORATORY AND SEROLOGIST ORLANDO OCHO.~, § P. 0. BOX 819 McAllen, Texas 78505-0819 §

MOTION SEEKING JUDGE TO CONDUCT A COURT OF INQUIRY PURSUANT TO THE TEXAS CODE OF CRIMINAL PROCEDURE ARTICLE 52 01.

TO THE HONORABLE JUDGE OF SAID COURT:

COMES NOW, Gustavo Mireles, the Complaintant in the above numbered and styled cause, and respectfully asks this Honorable

Court to Conduct this Court of Inquiry for the following reasons;

I JURISDICTION

This Honorable judge has jurisdiction to conduct such an inquiry, pursuant to the Texas Code of Criminal Procedure

Article 52.01. (a) because; when a judge of any district court of this State acting in his capacity as a magistrate, has probable cause to belive that an offense has been committed against the laws of this stater he may request that the presiding judge of the administrative judicial district appoint a district judge to commence a Court of Inquiry;

II. PROBABLE CAUSE TO INITIATE A COURT OF INQUIRY WHEN AN OFFENSE HAS BEEN COMMITTED AGAINST THE LAWS OF THIS STATE, Relevant Facts

In December 12, 2001, Serologist Orlando ochoa who was a forensic analyst for the Texas department of Public Safety DNA

Crime Field laboratory conducted a DNA analysis concerning the Capitol Murder of victim Mary Jane Rebollar, He compared

ON~ biological matter that was alleged to be left behind at the crime scene, to ComplaintantGustavo L Mireles's DNA biological matter genetic fingerprint. The DNA testing policies and proc- edures utilized by analyst Orlando Ochoa were Short Tandem

Repeat (STR), and Polymearse Chain Reaction, (PCR) DNA loci

search and compare analyzation. When conducting the analysis, analyst Ochoa searched and compared only 9 DNA loci, (locations).

He matched 2 to 3 loci to the Complaintant's DNA samplev He then concluded that because of this 2 to 3 loci match, he had obtained a positive consistant match~ However, serologist Ochoa's protocol

and methodology that he used to conduct the DNA analysis and comparission, was not an acceptable forensic science standarJ.

The required and acceptable forensic standard was to search Zor 13 loc~ (lbcations) of DNA from both the crime scene DNA and the suspect's (Gustavo Mireles) Complaintant's DNA sample. This DNA analytical methodology had been established by the Federal Buerua

of Investigations Department nation wide begining in October of 1998; 3 years prior to the bNA analysis being conducted in this case by serologist Orlando Ochoa. (See attached Exhibit -A).

Serologist Ochoa knew about the 13 loci match requirment, because he testified at trial that some times during DNA testing analysts searched for more then 9 loci, that they searched for 13 to make it more specific to an individual. (See exhibit-S RR. Vol. 9. pg

32 lines 14 to 17). In ihe instant case .he only searched for 9 loci RR. Vol. 9 pg 24 lines 1 to 20, and was only able to match

2 to 3 loci .(see exhibit-B). This 13 loci match is thP protocol that was established by the FBI for all accreditied DNA laborat- ories to follow. (See exhibit-A pg. 5 tiltled "Back to High School Biology" and pg. 98 titled "Other genetic locations'').

Therefor, since 1998 the FBI established that if the DNA analyst

did not manage to match all 13 loci, from the crime scene to the suspect's DNA sample 13 loci, the analyst had to concluded that the crime scene left behind DNA being compared came from some other person instead of the suspect. (Se~other genetic locations on pg.t~~J. Orlando Ochoa testified under oath to a jury and that he had made a positive ~atch from 5 items of DNA biological matter, that were alleged to be left behind at the crime scene.

(See exhibit -B RR. Vol. 9 pg 19 lines 4 to 17 and pg. 23 iines

1 to 23). By testifing that Gustavo Mireles was thePsource~of the crime scene DNA and that the DNA was"consistant" the analyst and the DNA laboratory are stating that this DNA profiles originated from this particular individual,(Gustavo Mireles). He testified under oath to the jury saying that this facts were true and corrct, even when he knew or should have known as an expert wtiness, that in order to concluded that he had made a positive

consistant, source atribution match, he had to search for and match 13 loci instead of only searching for 9, and only matching

2 to 3 loci. Orlando Ochoa delibertly committed "Aggravated

Perjury" in doing so, which is an offense against the state of Texas~ pursuant to the Texas Penal Code § 37.03 which states that: (a) person commits an offense if he commits perjury as defined in Section 37.02 , and the false statement is made:

(1) is made during or in connection with an official proceeding;

(2) is material. Orlando Ocha, made a false statement under oath and sweared that it was the truth. It is reasonably convincing that because Ochoa, -~~ew about the 13 loci search and match, prior to testifing as state expert witness, but decided to tell the jury that even though he had matched only 2 to 3 loci he had made a positive match, from the crime scene DNA to that of Gustavo

Mireles's DNA sample, he escalated the perjury offense to aggravated perjury; because he knew that the false DNA analysis

information contained 'in his expert testiminy was made during and in connection to an official proceeding. Ochoa's DNA testimony was the sole and primary evidence that linked that Complaintant to the crime scene. It was also the only evidence utilized to obtain this instant conviction. (See exhibit-C).

Furthermore, Ochoa committed the offense "False Report to

Peace Office or Law Enforcement Enployee", pursuant to the Texas Penal•,Code §37.08. when he submitted the DNA test r~sults as trustworthy to Investigator Joel Castro, so that he could then submitt them as evidence to the District Attorney Rene

Guerra, to use as addmisable evidence at trial.

Orlando ochoa,further committed the offense of Tampering . With or Fabricatin9 Physical Evidence pursuant to the Texas

Penal Code § 37.09. (a) (1) (2) by altering his analysis

to read that he had made a conclusive matcht and presnting and useing Lhe test results as true1 Mnowing of the DNA tests results

falsity and with the intent to affect the course and outcome of the investigation and official proceedings, which resulted in a conviction and sentencing of Gustavo MirEles to life in prison.

Orlando Ochoa/ further commited the offense of Tampering.

With a Goverment Record pursuant to the Texas Penal code§ 37.10. (a) (1) (2) (3) (4) (5) (6) 1 when he knowing made the false

entry and alteration of a goverment record; he presented the record State's #105 and #106 with knowledge of it's falsity and with intent that it be taken as a genuine govermental record; impaired the verity of the goverment record; got paid by the state for the use of the record; presented the record with know- ledge of it's falsity. The McAllen, Texas DPS Crime Field Lab, to

include it's director Thomas A. Davis Jr., Frankie Waller and David MCeathron assistant Directors, ~new or should have known before authorizing ±he re~ease of this fraudulant test results; that they were false and conducted under false pretense. By allowing the test results to be released and submmitted as

evidence to the Hidalgo county prosecutor, Rene Guerra, the McAllen Laboratory and it's dir~btors commited the ofense of the Texas Penal code § 43.06. Acomplice Witness; Testimony and Immunity (a) (b) (c) (d)

District Attorney Rene Guerra and the trial judge Mario

Ramirez Jr. of the 332ND criminal judicial court committed the offense pursuant to the Texas Penal Code § 39.02. Abuse of Official Capacity (a) (1) (2) and Texas Penal Code §39.03.

(a) (1) (2). Both Rene Guerra and Judge Mario Ramirez jr. should know the laws of the state of Texas and the laws established by the Federal Goverment. This is very important when both are the "Gate Keepers' of the evidence being submitted to them as being trustworthy, reliable, by the investigating peace officers.

Both should have known that the legislature had passed in Sept 1, 1995 1 the DNA Act, which included the Regulation of DNA Testing; issued by the Executive Branch Department of Public Safety

Title Chapter 4 Section 411, and Sec. 411.0205, 411.0206, 411.144

and The Administrative Code Refrence DNA Database Testing See, TAC § 28.1 et seq. which states that: (b) A DNA Laboratory or criminal justice of law enforcement agency shall follow the procedur~s: (1) established under the director of this section; (2) specified by the Federal Beurea of Investigations, to include the use of compatable testing procedures, laboratory equipment, supplies and comparable computer software.

[*11]

Before allowing the DNA Test results to be admitted as addmissable evidence under the Texas Rules of Evidence/ they're ethical obligation was to ensure that the evidence; in this case the DNA test results were not fraudulant1 and met the standard

opperating procedures, specified by the FBI, or comparable and compatable to them. The DNA test results in this case are not ,. even close to a compatable or comparable status requirment; when analyzing DNA test results. Both Rene Guerra and Mario Ramirez

Jr. recomended to the Court of Criminal Appeals to deny a pri-

vious collateral attack on this same issue saying that the FBI's standards and guidelines were meritless and not absolute.

The CCA agr~ed. All have abused they're discreation and official capacity as administers of justice/ by allowing the Complaintant

Gustavo Mireles to remain incarcerate to life in prison, kbowing that the DNA test results utilized to obtain this conviction are unreliable/ fraudulant, inaccurate/ misleading, and unacceptable forensic science then when the results were conducted in 2001, and now. (See attached •xhibit- D)

PRAYER

Do to the reasons contained herein, the Complaintant prays that this Honorable court enter a ruling granting this motion to conduct a Court of Inquiry, in the "intrest of Justice".

Signed this 16th day of June 2014.

Respectfully Submmitted, /sllJ. ,/!J@ll7 ..j · ;tf i vi> Gustavo L. Mireles 3001 S. Emily DR. McConnell unit Beeville, Texas 78102

r '0 INMATES DECLARATION I Gustavo Lopez Mireles, presently incarcerated at the Texas Department of Criminal Justice Division located at 3001 S. Emily Drive, McConnell unit, Beeville, Texas, due solemly swear under penalty of purjury that the foregoing facts are true and correct to the best of my knowledge. Signed this 16 day of June 2014. INMATES SIGNATURE Case No. CR-3196-01-F STATE OF TEXAS § IN THE 139TH DISTRICT COURT § § § vs. § OF § § § GUSTAVO LOPEZ MIRELES § HIDALGO COUNTY, TEXAS ORDER On this the 14th day of August, 2014, the Court having examined the pleadings, record, and the submitted transcripts, FINDS that there is lack of substantial facts to establish probable cause for conducting a Court of Inquiry. IT IS THEREFORE ORDERED that a Court oflnquiry not be conducted SIGNED AND ENTERED on this the 14th day of August, 2014 ~ruDGE I May 27, . 2014 HIDALGO COUNTY DISTRICT CL~R~S OFFICE ATfN~ LAURA. HINOJOSA .· . _·. ·-~-~~rrrF-~%9~:-:~~eQRTHousE·- ·-. -~ .· _.... ~ -~··----- By .. ... . ... ."1,0.0 ",N..,,,:,,CI:,.O,S,NE R, . BL V:,D••..•.. , ··· · . ·rJ?!Io'~~'~shx"~oR'lfwE:~R: ;:-s-7' '}l)·'a.':. .· . ·! EDJNBURG, TEXAS 78540-0087 ·f . I , / Dear Honorable Clerk:· .· . ·.··· . . . . ...:1 fJ.·· 1e. ·st:.,_·. .ri·ct Please, if yo.u could, :would you be so kind an u te .01 ·· t,h,,i~s foregoing motion for disclos.ure in the 206th st:eyi'l.a Cou1:-t,· 'Hidal,go. cqur1ty courthouse, judge Rose Guerra 0 pr~si:d:ii19. . . . civ.ed. an· ~as . . Please, notify me when this ·motion. has. been re: root :Lon j.Cle f.l.led '· as_ I haye ,no qtl}~r me.ans, to ver1fy that th J.. ~ure ~rt. filed, pursuant' to. the 'Texas. Code of Criminal Proc e · · · 0 rtant 2.21. [Duty of cle;rks] Sec.tion (a), (1) (2) (3) (6)·erY imP· Thank you for your; t_ime and at tent ion to this ~ · . --~R.~s'ii..;EJ;:,,g. ~:nt:.~:~<;.l!ts#J?·e.r...,~>-···"";,,;)<"'~"'',."",;.;;·""""~'·•·~"'-'"'...."';;•;..; ..~...·._•..........,,__~~'""''"·-····· -~·*·'· ·"' ...·. . - Sincerly, ~~~>B.~ I.. GUS'fAVO J. fl•. MlREL.ES ... . ... - . ·. -~ .. j)R• ENCLOSURES: I RS~E -:t:); • -CC: :INNOCENCE PROJECTS OF TEXAS, LEON OR MAT.~NO 1 58 9 . (si S toe CAN'YON,-LAKE, TEXAS 78133, C~11: (5_12) 787-1180; / Cause N.o: Ex-parte § ' IN THE 206TH STATE I ~1MfS.~][) 1 Gustavo L-. :Mire1.es § _§ DISTRICT COURT HID!\:.G_O,.,P~'"P.,~-J~ -&'t'Ri~~~--M v. § Rene Guerra §. Hidalgo County, Texas § E:PI-N:BURG; TEXAS MAY 3.0 .:'2 . ,:.·: :-.~~~ .. District At~orney :.-t~- Edinburg, Texas · § § :c{i ·:. MOT:j:ON FOR DISCLOSURE CONCERNING .. · ._·'PURSUANT TO THE DUE PROCESS CLAUSE OF ~~~f';~~~,~~~'"o~iti~*iWliG_:~:;::~;:,~,::,~~T,;·-·· · COM_ES NO.W _Gustavo L ~ Mir~les, in the above mentioned and styled ca.use, and wi_ll respectfully sh9w this .Honorable Col}rt ~thei f~o~llowing: i.I:: ;:idRISDICTION Th-is ho.n 0 ~:able co.urt h_as the jurisqiction _to grCl.nt tnis •<' - - ~-:. Kyles v. Wh;i;tlyl_514U. s. 419,433 (1995), United Sta1;.es V• Bagley~_ 473 U.s:<;·-66~_;·~~::;.p81 0" .(1985.)!_United States y. Agurs, 427_, U.S. 97, 107 (1976); Braqy v_., Mar_yland, 373 u.s. 83 (19'63) Ex part,e Mqw.bray, 943 S. w. 2d 461,. 466 (tex .cr. App. 1996) the State has an "afirmati ve duty"·, ';:o disclose favor~ble evide·nc_e •. The State has a continuing duty to disclose favorable ev.idenc9. At tri:a1 this duty is enforced by the requirements of due process, but after a conviction the pros~cutor also ~$ bound by the ¢t_h {cs ot .hl.s office to info-r-m. the defendant or a_?pro- priate a.uthori ty of afte.r-acqub':ed or other information that casts doubt upon the corr~ctnes s of the convi.ction. (see' Imbler v •. Pacht_man, 424 u.s. 409, 427 (1976) (FN25).

--------~• .__L__

Cause No:• § Ex-parte IN THE 206T~ STATE GustiVo L. Mireles § ' .. .~

§ DISTRICT COURT IN THE V• § HIDALGO COUNTY COURTHOUSE IN Rene Guerra § Hidalgo County, ~exas § . EDINBURG, TEXAS District .Attorney Edinbur·g, Texas § .§

MOTION FOR DISCLOSURE CONCER~ING EXCULPATORY MATERIAL PURSUANT TO THE DUE PROCESS CLAUSE OF THE FOURTEENTH AMENDMENT OF THE UNITED STATES CONSTITUTION.

TO THE HONORABLE JUDGE OF SAID COURT:

COMES NOW _G..u~c~.5!Y,9.,.,L. Mire!~~!~. in _t_ll.e..__ ab~y._~-~~n-~~~o_l_led and s:tyled cause, and will respectfully show this Honorable Court the following:

I. JURISDICTION This honor~ble ~ourt has the jurisdi~tion to grant. thiA motion everi ~ithoUt a request for Brady eVidence, material

evidence which is faVorable to the accused. (See, Kyle·s v. Whltly, 514 u. s. 419, 433 (1995), United States v. Bagley, 473 u.s. 667, 680 (1985); United states v~ AIIJurs, 427, u.s. 9Ti 167

(1976); Brady v. Maryland, .373 u.s. 83 (1963) Ex parte r<lowbralt•

943 s.w. 2d 461, 466 (.tex cr. App. 1996) the state has an

"afirmative duty", to disclose favorable eVidehte.

·~~id::·~~-~::t-:~!Jf''·~~rt~:::f~,~~~~~~j~~~~lJ~~f~f~is of due process, but after a convic~i-on the prosecutor aLso is boodd by the ethic& of his office to infor• the ~e6endant or a~pro­ priate authority of after-acquired or other information that casts doubt upon the to~rectness of the conviction. (see, Imbler v~ Pachtman, 424 u.s. 409, 427 tl976) (FN21).

I I.. DISCLOSURE EXCULPATOFU MATERIAL BEIN<;· SOUGHT RELEVANT F-ACTS On June 27, 2001; at 8:3.5 o'clock PM Magistrate judge Rose Guerra ieyna ; issued a search warrant in case #OL-13077, for the e~1straction of blood samples, saliva, body hair, and pubic hair, belonging to Gtistavo Mireles. Tt was the belief of th the Affiant liidalgo County Sherriff's Department Investigatorr Noe Canales, that these DNA samples taken from ~ustavo Mireles .. ·. ·- and submitted to the Mcallen texas arSmeirime Field DNA laboratory for comparison, would show a match with the samples recovered from the victim. this would then constitute ev.idence tending to show that Gustavo Mireles had c:::ommitted the Capitol Murder of Victim mary .Jane Rebollar. {See attached exhibit A). The order was executed on June 28, 2001, wi th.out. the consent of Gustavo tdirele·s ., who was did not trust the Hidalgo county investigation department, due to curruptl.on atributes; which had beeti well established through out the histoty -of the ~idalgo County, Sherriff's department.; as it continues to be establi.s.hed in regards to the Panama Unit, and former Sherr Lff Lupe 'I' rev ino 's ·plea of g.uil ty to currupti-2!1.-<,charges. ·.-· ·.- .... ,.. ·' - .· :":· (;·~ ~-;,> ..:-: . Defendant Gustavo mireles was tried -and convicted to life in prison, based soley and pr i mar·ily on the DNA evidence testimony and tes:t r.esults conducted by the McAllen . texas DNA Laboratory. However, just several months after GUstavo Mirles 's conviction,_ the DNA laboratory of McAll~n texas was secretlt closed ~itnout notifying ~he- Hidalgo county District Attorney's office. (See attached exhibit B).

The seceet ciosure was first made public in'March 15, 2004. IJbetavo Mireles had already been convicted and 'sentenced: to life in prison, in A.ugust 8, '2002. the l.aboratory was secretly closed through June an·d septemberrof. 2003. District Attorney Rene Gueraa

hirtrself told the News media that•If the DNA evidence piayed a major role in a ~e£endant~s conviction on cases that had already

been tried and aeijucated, that those cas_es had to be itemized and re...,evaluated. This was to make sure that all the DNA testing policies and procedi.ire:a~<had b_een properly- followed when con- ducting the DNA •nalysis on cases~

DPS spokeperson Tom Yinger~ told the news media. that 40 cases had already been reviewed that had shown no faulty testing.

He further stated that the DPS·still had 187 more cases that needed to be scrutinized. (refit to attached exhibit BO. Spokewoman for the DPS, acknowledged to the news-, media that

it was approximately 300 cases that needed to be scrutinized inste.ad of just 187. tr~le.. 1"\(}.."'je.)' ' '

Ale~ Madki9al the director of the McAllen, fexas DNA DPS crime field Laboaatory, told the media and confirmed that the laboratory had .been using outdated blde~ DNA insttirments and pt.citoc~i~1-~ i -~sh i c h_ . were ·- •·•· - out- ~-;~·":~~~iJ.~~~~~~(~1:~~£~;;}~?;~'~£~oJ§~#~~~-fgg~~~~~;~¥~'~~~-' :~~:;/ procedureE:J". Dlhe director • a excuse was that- the labo.ratory was give'n permission to- use these outdated old protocols and instur- ments, because the labor.atory was 11 Gr.andfathe-red ;, . Analysts that were not involved in the .DPS audit, confirmed to the news media ·that the failure of. the Mcallen tx, DNA analyst to know the ·s~ns.itivity .. ... ·:· ·."'~· of the insturment used to determine DNA profiies, .- indj?da.ted that the·analysts were only guessing about the DNA ·:·.; .. test r~'sul ts.

ARGUMENT

Gustavo Mirela, asks this Honorable coUrt to ~ssue en administrative order I to es'tabl ish if GUstavo Mireles DNA. case lgency _-#0113077, Laboratory Case #L3M-48628, offense Date 6j23/0l

was re-evaluated. Also what were. the DNA testing policies and procedures and guidelines that were use·d in the evaluation

process and the analytical methodology utilized therein• Did the McAllen,, eexas DNA Laboratory conduct the &Olfilalysis in _?om-

IP1iance with and pursuant to the Executive Branch Dep-artment of Public Safety ti-tle 4. Chapter § 411, 411.144 Regulation of DNA

Laboratories; Penalties added by the Acts of 1995 74th Legisla- ture 59.5, 1: effective September _1, 1995; the Crime !.aboratory

Accreditation Proc·ess; See, V.T.C.A. Govt. code § 411.0205, a·nd

Regulation of DNA Testing Govt Code § 411·0206 Administratvie. COc1 Code refrence, DNA Database, See~ TlC t 2&.1 et seq~ whi2h

.states that : All na~artment of Public Safety DNA laboratories i:ri the United States. must and shall: · (a) the director by rule shall establish procedures for i:>NA laboratory or cri.minal justice law enforcement agency in the collection, preservation, shipment~ analysis, and use of blood sample or ot!1er spicimen for forensic DNA analysis in ~a ma.nn~r that parmi ts~.:,tl::l.~"'"-~-~<;,h.~,P,9e _:.~~ ..!:h.~.:c)?J.~"'~~~2~!-J!:.!~~:!~9~);:,v.;;;;;t,,, :~:<·>; .. ·. \~.·.,. . -. (~J~·~f~~~l:~.d:··~ ;-~~~rat or i e s an a: ,tJie(::u?S;~1:i~();f:~--~t'he"'~:~v.r~a)~'ff\~ ~);/:-i'l1';: a?- -· · - ·. '·' <: ·.. ·.· ··

(b) A DNA laboratory :6r:/ci:1mina·l justice of law enforcement agency shall follow the ·ptocedures: (1) established under the director of this section; and {2) specified by the Feder.al 13ureau of Investigations, to· include, the use of comparable testing procedures, laboratory eq.uipmant, supplies and compatable computer software.

Compatabl'e DNA testing procedu'res to those of the Federal Bureau of Investigation Bureau of, Investigationsspolicies and procedures would have required the McAllen, texas laboratory to utilize the standards used by the FBI to compare an·d match DNA samples from the crime scene to 41asttauocll!lsec1t!ts•s DNA sample and genetic profile. This analytical. DNA Testing methodology was established nationwid wide in 1998, which required identicle findings at a minimum of 13 alcbcfrent loci on the DNA from both the crime,scene and the suspect's DNA samples .. The 13 CODIS (Combined DNA Index System) core loci were and are: CSFlPO, FGA, TH01, TI?OX, VWA, D3Sll58, D5S818, 078820, D8Sll79, Dl3S3l7, D16S5·39, Dl8S5i, and D21Sll •. This was to ensure that the analyst had conducted his analysis .in compliance and had. searched for all 13 loci and matched them,· in order for the tiNA test results to be considered a "match". If the analyst was off' just 1 of these 13 loci, and even if he or she managed to match 12 other loci, he would have to agree that the source of the DNA sample belonged to some other indi- viduaL and. not the suspect. (See. attached exhibit C). Honorable Judge presiding Rose Gu~rra teyna, has just recently in. Febuary J0020l.~'";.."'~entenced .defendan"t Arturo Almaguer ·to 2 conse~utive .life· sentenc~:·~.:;~~;'"r~;~~'!:ilici'f~~,;·~oit'~~~:W\~,ha:.c,·~ W.ilda 8quires in 1988 ·"Cold Case''. It was this same FBI DNA testing policies and procedures that Rene guerra and his District Attorney's Office ut.ilized to link Almaguer to the crime scene, and convict him of the murders .. This DNA testing analytical methodology that was established by th~ FBI nationwide back in October 13, 1998. (See attached exhibitCC).

'' ·I•

Hidalgo county District Attorney, or no one from his Office, has ever. notified §ust'avo Mireles concerning the re-evaluation of his DNA· case files.; co,ncerning the DNA re,..testing and the pp&ic:ie p~li~ie$ and procedu~es used in the re-evaluation procesa. Gustavo Mir.eies; has a Constitutional Right, ·to be ·notified about the issue of the re-evaluation of his DNA c·ase file, ~·tht was used to incriminate him. If this evidence is disclosed, there :is a reasonable probability that it may be fa_vorable in _fu_ture appellate pro6eedingsi it and ~he~ the ~lip~essed evide~ce undermines the confidence in the out come of the trial• .It is and was Rene Guerra's duty to learn as an :individual prosecutor, ·of any favorable evidence known ·to others acti-ng on the goverment behalf in this case, including the police. (See, Kyles, 514 u.s. at 437-438, Ex-parte Adams, 768 s.w. 2d at 291-92). If error results iri the eharecter of the evidenc$, it 1 s not Rene Cuerra tfie prosec~tor, that d~t~rmirtes whether the supression of the evidence results in .·constitutional error~ tsee, · Agurs, 427 u.s. at 110.}. CONCLUSION . F~r. the reasons stated .. .in.:_,this moti_on, ,it .. ie· .the et}).icalc... .. ,, ····---~- -d~~{~i~-~~'---t~~:~~-.pr-~si;,d,ing magist~a·f~~;-~~f(;~l~i~~f~~,hif{;~~~:&©f~u'a~~;~t€:~-tt;2U~·~{';~F' <-··· ·•. ·f a "Mini~terial Act ··,··~ltfi'ch requires a trial court to consi'der and rule on a motion within a reasonable time. (See, Barnes v. state, 832 S. W. 2d 424, 42.6 · (Tex App. Houston [1st dist.] 1992 orig. proceeding). When a motion is properly filed and pending before a t-rial cour·t, considering and ruling on that motion is a · . . . ministerall act, and mandamus may· iss·ue to compel! the .. trial. · .. ·· court to act. (see, -Kissan v. Williams, .545' s.w. 2d 266-67, ( tex Ctv.Atp~. Tyle.r C?rig. proceeding 1976).

Mandamus is an appropiate proceeding in a criminal case if the relator shows that the act sought to be compelled is pi.ir.e:ly mirtistekial and relator has na other w•pedy at law~ (see, Simon v. Levario, 306 S. w. 3d 318-2CD ( tex cr. App. 2009) • PRAYER

Rela.to:t, Gustavo mireles, prays that this Honorable Court

ent·er a ruling concerning the issues presented in this motion, and that the cour_t act in .it's ministerial duty, when .. doing so. Furthermore, Relator asks this court to ·grant this motion,. :and

compel! Rene guerra or his district attorney's Office, to properly inv-estigate in a timely manner, artd check and see Lf

Gus.tavo Mir.eles' s DNA case is. analysis, we.re re-evaluated; and to provide Gustavo mirelea with such re-evaluation, to include the analytical met hodoiogy utili zed in conducting the re- evaluation 8K&lforensic analysis .•

Si~ned on this 27 day of May 2014. Respectfully Submitted~

I sr , f1v-ka - rY. !l<iu/h- __ Gustavo L. Mitl.es 3001 s. 8mily .Dr. TDCJ-ID ill28895 ~- -· ··"",_;·-;:~--,..Mcconne-1 i~"'-u-ni t:':"'·,: .:·-,::.~:-~:-:;·:- ··=·t:·;-e;_<;;;,:C::} ·-· - .· .. ;. ~-·... . . -8~:~~,±-11~-; · i'a;ta.i:·.-;ialoi ~-

>i.N.MATE DECLARQATION I Gustavo Mireles, bei."rig presently incarcerated at the 'Insti- tutional llivision,of t_he Texas Dept. of correctional -Justice Mcconrtell unit, bee~ille, te~as, swear under penalty of purjury that the foregoing facts ~nd documen~s are true and correct to the best of my knowledge •.

Signature<,.

7 \ i NUECES COUNTY COURTHOUSE CHIEfP JUSTICE 901 LEOPARD, 10TH FLOOR ROGELIO VALDEZ CORPUS CHRISTl, TEXAS 78401 361-888-0416 (TEL) JUSTICES 361-888-0794 (FAX) NELDA V. RODRIGUEZ DORI CONTRERAS GARZA HIDALGO COUNTY GINA M. BENAVIDES ADMINISTRATION BLDG. GREGORY T. PERKES NORA L. LONGORIA QCourt of ~peal~ 100 E. CANO, 5TH FLOOR EDINBURG, TEXAS 78539 956-318-2405 (TEL) CLERK DORIAN E. RAMIREZ tEbfrteentb mtstrftt of tEexas 956-318-2403 (FAX) www. txcourts.govl13thcoa December 18, 2014 Mr. Gustavo Lopez Mireles Hon. Rene A. Guerra TDCJ #1128895 Criminal District Attorney 3001 S. Emily Drive Hidalgo County Courthouse McConnell Unit 100 N. Closner, Room 303 Beeville, TX 78102 Edinburg, TX 78539 *DELIVERED VIA E-MAIL* Re: Cause No. 13-14-00600-CR Tr. Ct. No. CR-3196-0 1-F Style: Gustavo Lopez Mireles v. The State of Texas Enclosed please find the opinion and judgment issued by the Court on this date. Very truly yours, ~~$. ~~ Dorian E. Ramirez, Clerk DER:jgp En c. cc: Hon. Rose Guerra Reyna (DELIVERED VIA E-MAIL) Hon. Laura Hinojosa (DELIVERED VIA E-MAIL) State Prosecuting Attorney (DELIVERED VIA E-MAIL) Hon. J. Rolando Olvera Jr. (DELIVERED VIA E-MAIL) ~. :( :- .' . .. · ._, ·",.. .~ . ~ ·.\. . .. ' . ··- 'l' '\ '' ··~-" '·"·:' THE THIRTEENTH COURT OF APPEALS 13-14-00600-CR Gustavo Lopez Mireles v. The State. of Texas On Appeal from the 206th DistrictCourt of Hidalgo County, Texas Trial Cause No. CR-3196-01-F JUDGMENT THE THIRTEENTH COURT OF APPEALS, having considered this cause on appeal, concludes the appeal should be dismissed. The Court orders the appeal DISMISSED in accordance with its opinion. We further order this decision certified below for observance. December 18, 2014 NUMBER 13-14-00600-CR COURT OF APPEALS THIRTEENTH DISTRICT OF TEXAS CORPUS CHRISTl - EDINBURG GUSTAVO LOPEZ MIRELES, Appellant, v. THE STATE OF TEXAS, Appellee. On appeal from the 206th District Court of Hidalgo County, Texas. MEMORANDUM OPINION Before Chief Justice Valdez and Justices Garza and Longoria Memorandum Opinion Per Curiam Appellant, Gustavo Lopez Mireles, prose, filed a notice of appeal on October 14, 2014, from the trial court's September 29, 2014 denial of appellant's "Motion for Disclosure Concerning Exculpatory Material Pursuant to the Due Process Clause of the Fourteenth Amendment of the United States Constitution." This Court previously j The Court, having examined and fully considered the notice of appeal and the documents on file, is of the opinion that there is not an appealable order and this Court lacks jurisdiction over the matters herein. Accordingly, this appeal is DISMISSED for I lack of jurisdiction. All pending motions are likewise DISMISSED. PER CURIAM Do not publish. See TEX. R. APP. P. 47.2(b). Delivered and filed the 18th day of December, 2014.

( ATTACHED EXHIBIT B Consist of: (1 ) Cause NO: CR-3196-01-F State of Texas v. Gustavo L. Mireles Reporter's Records Volume 9. Trial on the merits, on the 6th day of August 2002. State Forensic analysis Orlando's Ochoa's. trial testimony. (2) EXECUTIVE BRANCH DEPARTMENT OF PUBLIC SAFETY TITLE (A)-(a,) • J . • . frl~g~~n,;,Ufe~ic~~~~iai"lififl~'iiio'WFof£h:illn:an~'!!..~~""1n>.'!!Y~' (O":...tli·~-~DNA-:c:latabase·;must'be comlfaulileWjth the ·nation~! DNA identifica..:_ · ·disaster,:or:.forc[tluinariitaR'~~es·

::·, f.:..~~~~· .;?'>'<ct'-;i-~.-!:.~~ ...- ·- . ·· -r--.::tf~ • =lion-index S}'!lteni (CODis)-usecfbY.iliii: BJJ tcithe.extent ·ffiillii-ed by.the FBI--tQ/ (2) assisting in the. identification of living or deceased missing persons; r~"frnl(th~~fUI.:'i;xcliirige·ai:!ct:sior:age~of,DNAxecorikorinfonnation·deriv~.d and ·: ..~Arom.those reoori:IS.)- ·· · . '· . . · ~'-''"""-"""'DN·;;,.v:.~~~.·· (~ei ..,~·· ~""'""'~D-N-~:!!!~:;':i'cc:•"'it!'!?'t•t·I""'"''"""'D'I.;,~ '1"" (3) if personal identifying information is removed: shall: . I. In general For purposes of Fourth Amendment analysis (1) forward the DNA record of the analysis to the director at the depart- of legality of blood. draw ordered pursuant to 3. Privacy rights · · ,., ment's crime laboratory or another location as required by the department; statute, purposes of statute establishing state Statute permitting juvenile courts _to require DNA 'databank demonstrated need for DNA submission of blood or other samples for pur- and samples beyond normal need for law enforce- poses of DNA records as condition of probation (2) comply with this subchapter and rules adopted under this subchapter. ment; statute was not designed to discover and in delinquency adjudication proceedings did not produce evidence of specific individual's crimi- promote traditional aims of punishment, despite (e) If a DNA laboratory violates this subchapter or a rule adopted under this nal wrongdoing. In re D.L.C. (App. 2 Dist. 2003) 2003 WL 22976095. Searches And Sei- potential deterrent effect of existence of offend- subchapter, the director· may prohibit the laboratory from exchanging DNA er databank, for purposes of determining zures e=> 78 whether statute was punitive in its effect, as records with another DNA laboratory or criminal justice or law enforcement Statute permitting juvenile courts to require element of ex post facto analysis, where legisla- A DNA laboratory prohibited from exchanging DNA records under submission of blood or other samples for pur- tively stated purpose of statute was identifica- this subsection may petition the director for a hearing to show· cause why the poses of DNA records as condition of probation tion, that is, to exclude or include registrants as iri delinquency adjudication proceedings was suspects in past and future offenses; and laboratory's authority to exchange DNA records should be reinstated. not punitive on its face, for purposes of ex post "threat" of blood draw was not, in itself, signifi- t' facto analysis; statute's location in dispositional (f) The director is the liaison for DNA data, records, evidence, and other cant enough to deter potential offenders from portion of juvenile justice code did not render committing sex offenses. In re D.L.C. (App. 2 related matters between the FBI and a DNA laboratory or a criminal justice or statute punitive, and legislature's express, pri- Dist. 2003) 2003 WL 22976095. Constitutional law enforcement agency. · · ' · mary intent in creating DNA record was to Law e=> 203; Infants e=> 132 assist with identifications in past and future· sex (g) The director may: ·· offenses. In re D.L.C. (App. ~ Dist. 2003) 2003 Statute permitting juvenile courts to require WL 22976095. Constitutional Law e=> 203; In- submission of blood "r other samples for pur- (1) conduct DNA analyses; or fants e=> 132 poses of DNA records as condition of probation (2) contract with a laboratory, state agency, private entity, or institution of in delinquency adjudication proceedings did not 2. Purpose impose aft1rmative disability with respect to ju- '"'higher education for services to perforrii DNA analyses for the department. For purposes of Fourth Amendment analysis of the legality of a blood draw ordered pursuant venile probationers' constitutional · privacy rights, for purposes of determining whether (h) The institutional division may: .... to statute, the primary purpose of the state DNA statute was pun;tive in its effect as element of ex (1) collect a blood·sample or other specimen for forensic DNA analysis; or databank is to assist in investigation or prosecu- post facto analysis; constitutional rights of juve- tion of sex-related offenses or other offenses in nile probationer$, including constitutional pri- (2) contract with a laboratory, state agency, private entity, or institution of which biological evidence is recovered and to vacy rights, were diminished, and possibility of higher education for services to collect a sample or other specimen under this exclude or identify suspects; secondary pur- wrongful disclosure of information was mini- poses are to assist in recovery or identification mized by statutor1 limitations on disclosure. In subchapter. of human remains from a disaster or for hu- re D.L.C. (App. 2 ·Dist. 2003) 2003 WL Added by Acts 1995, 74th Leg., ch. 595, § I, eff. Sept. I, 1995. · Review: 40 crime lab cases accurate Page 2 of4 i

[*78]

Rodriguez said his department might now bring DNA evidence to j a private company. <I ·j The DPS shut dpwn the lab after ,a June 3 internal audit which i !

found serious procedural flaws. The flaws included sexuakassault kits which were not adequately sealed, chemical reagents for DNA testing that were not labeled or had expired and the reuse of chemicals in DNA testing, according to an investigation published Monday by the Houston Chronicle. k, J The suspended head of the DNA lab, Alejandro "Alex" Madrigal, i l told the Chronicle that approximately 300 cases were under ;l ·j review fpr possible mishandling of evidence. . I ··. 1" I

! ! The Monitor was unable to reach Madrigal for this article.

Some defense attorneys said they were concerned with the information, but said· very few cases rest solely on DNA evidence I

LABORATORY AND FORENSIC MEDICINE ASSOCIATES

JOHN PLUNKETI

1 30 1 3 WELCH TRAIL TELEPHONE: 507-263-4022 WELCH, MINNESOTA 55089 E-MAIL: [email protected]

March 25,2014 Re: Your January 27,2014 letter Mr. Gustavo L. Mireles McConnell Unit 300 I S. Emily Drive Beeville, TX 781 02 Mr. Mireles: I received your letter and the attachments, including: I. A copy of a letter from you to Dr. Harry Bonnell, dated December 3, 2013, and Dr. Bonnell's responses, dated December 16 and December 19, 2013; 2. Partial transcripts of trial testimony by Criminalist Orlando Ochoa; 3. State's Exhibits #105 and #106, Texas Department ofPul:iic Safety Physical Evidence Submission Form and DNA Analysis; 1 4. A copy of evidence items #5 and #6, a bloodstain lift; i 5. State's Exhibits #60 and #62, uninterpretable B&W plain-paper copieJ showing victim's hands; 6. State's Exhibits #103 and #104, Physicai Evidence Submission Forms! 7. A letter from the Innocence Project of Texas to you, dated February 24, 2009; and 8. Media articles regarding the McAllen DPS laboratory. I agree with Dr. Bonnell's analysis as stated in his December 16 and December 19,2013 letters. "Positive" DNA identification requires a minimum of matches at thirteen loci, not two or three loci. "Consistent" profiles at two or three loci have little significance, other than stating that analysis at these loci does not eliminate you as a potential contributor to the source material. Dr. Bonnell suggested that you contact the Texas Center for Actual Innocence (TCAI) and the Thurgood Marshall School of Law Innocence Project. I am familiar with both organizations and have worked withthe directory of the Thurgood Marshall Project in the past. In addition, I noted that you have had corresponded with the Innocence Project of Texas (IPOT). I know the directory, Gary Udashen, personally. I encourage you to contact IPOT again and let them know that I am willing to help you. I would also contact TCAI and the Thurgood Marshall Project and send them copies of this letter. I am not familiar with 2001 Texas standards for admissibility of scientific evidence such as DNA ... nalysis. One of the Innocence Project Attorneys will be able to help you with ~his issue. Finally, I have copied the records you sent me and am returning your copies with this letter. Sincerely, John Plunkett, M.D. JP:dp Enclosures cc via e-mail: Harry Bonnell, M.D. Mireles re: Mireles March 25,2014 Page I of I U.S. Department of Justice Office of Justice Programs National Institute of Justice Washington. D.C. 2053/ Gustavo L. Mireles # 1128895 . TDCJ McConnell Unit 3001 South Emily Drive Beeville, TX 78102 Dear Mr. Mireles: I Thank you for your letter on March 11, 2014, requesting information on DNA testing policies and procedures. Specitib DNA processing policies and procedures may vary by laboratory, but publications pert ining to DNA can be found, and are available to the public, on the NIJ website through htt ://ni'.nc'rs. ov, in particular DNA for the Defense Bar at: https://www.ncjrs. gov/pdffiles 1 r1ij/23 797 5 .pdf. In addition, other resources may be available through your local Innocence Project, the closest local facility is the Innocence Project of Texas, 1511 Texas Avenue, Lubbock, TX 79401, or by phone: (806) 744-6525, email address: [email protected]. Other DNA related materials are available on the NIJ website, including information on postconviction DNA testing at: http://www.nij .gov/topics/forensics/postconviction/welcom.htm and http://www.nij.gov/topics/forensics/postconviction/wrongful-conviction.htm. ' Courtesy of the National :Institute of Justice (NIJ), please find enclosed a copy of Post- Conviction DNA Testing and W)fongful Conviction and also the publication of DNA for the Defense Bar. Sincerely, National Institute of Justice Enclosure: ..,; · ... . .~ · ..:" JUNE 2012 DNA for the Defense Bar www.NIJ.gov CHAPTER 2 DNA Basics: The Science of DNA Section 1: What Is DNA? brown eyes and· carries a Bb profiie, tl>eir childrer, vvill statistically be expected to look l;ke this: 25% Deo"y(;t;onuclc•c <-lCid iDI\!A/;s somet1mes called BB (brown eyest 25% Bb (brovvn eyesl. 25% bB a genetrc blueprint because it conta1ns all of (brown eyes). and 25% bb (blue eyes). Each of the 1nstruct1ons that determine an individual's these four profiles reflects the d1fferent possible genetic characteristics. A technical explanation of combinations given the genet;c charactenstics of DNA can be found at http://www.genome.gov/ the original DNA of dad and mom. glossary/index.cfm ?id=48. What is DNA made f.)f? Where does nuclear DNA come from? DNA is found in the cells of all living organisms. Our parents. All human cells with a nucle,_!S, except red blood cells. DNA is actually a com- except gamete cells- egg and sperm cells bination- called a DNA sequence- of four - have DNA cpntaining the full complement bases: adenine, cytosine, guanine and thymine. of 46 chromosomes. Each egg and sperm commonly referred to as A. C. G and T (see cell carries half of the DNA complement (23 chromosomes). H!MCitPEI .d& X Figure 1: NuCI: otide Base Pairs Mixing of genetic markers occurs across the DNA molecule during the formation of sperm cells and egg cells. Because of this mixing pro- cess. the DNA in all sperm cells from one man or all egg cells from one woman are not equal halves "split down the middle." Rather, each - genetic characteristic has a 50% chance of presenting itself in any given egg or sperm. In humans, very few observable traits are due to inheritance of only one gene. Most observable characteristics are the result of the products - of multiple genes interacting. Although actual - inheritance of eye color is complex, the follow- ing example simplifies the concept of inheritance of eye color for illustrative purposes. Consider a male with brown eyes who inherited a brown eye gene IBl from one parent and a blue eye gene (bl from the other. His "eye genes" will be depicted by geneticists as Bb. (Remember this from high school biology?) Half of his sperm cells will have the B (brown) gene, and half will have - the b !blue) gene. Simplistically, the color of his children's eyes will be dictated by two factors: Source Christme Funk. Working Group MeMber what gene he gives them and what gene their mother gives them. If the mother likewise has r. 3 _r CHAP T E R 2 Frgure 1 ). These :u.:r :!Yot".'i, 1n varying combrna- tions. r~lake up yeasl. bananas. chickens. rice and rtr 1w u· nm··...,...•·Mr:mms Figure 2: The DNA Double Helix . - peop!e as well as cl! other living organisms The principle of sequence formation is not unlike the principle of the English language. The 26 let- ters in the alphabet (or the four bases in a DNA sequer,cel can be combmed in various ways to make different vvords. "The" and "theory" have three 1etters 1n common -both in the specrfrc letters used and the order of the first three let- ______.:....:.:. ters. Yet the word "the" has no application to __J_....JI._ Double C G the w?rd .. theory ... heli~ ( · .,_. Likew1se. in music. there are 12 'elements: seven notes (A. B. C. D. E. F and G) an9 five sharps or \ flats. Playing these notes in different combina- tions creates "The Flight of the tumblebee ... Pachelbel's ··canon in D" and th theme song to "Charlie Brown." I ~-· Source: John Butler. National Institute of Standards With DNA. instead of 26 or 12 elkments. there and Technology. are the four bases mentioned above. Just as the combination of notes dictates what the music sounds like and the combination of letters dic- tates the word. the combination ·of As. Cs. Gs Bases pair up to form the "steps" of the DNA and Ts dictates tl:le type of livingithing. molecule. The sides of the DNA molecule are made up of sugar and phosphate chains. The DNA of all human beings is actually nearly identical. Approximately 99.9% of the sequence Our interest is in the bases themselves. Imagine of As Cs Gs and Ts is in the exact same order. straightening out the DNA molecule to make a This dete.rmines common humarn features such ladder rather than a spiral staircase. Each step as two eyes. ears on both sides ~f the head. of the ladder is a single base pair. As indicated and long bones in forearms and alves. Although above. there are about 3.2 billion base pairs looking at these parts of the ON molecule. in the DNA molecules comprising each set of might help us determine it is hu an DNA- human chromosomes. rather than. say. banana DNA- it isn't helpful in distinguishing one human fro another. Each base pair consists of either an A matched with a T a T matched with an A a C matched There are however. places on the human DNA with a G·. or a G matched with a C. That's it. molecule ·that are different. Of the approximately Those are the only .four combinations of base 3.2 billion base pa;rs in the human genome. a pairs that exist. Bases that pair with each other forensic DNA-typing test looks at about 3 thou- are called complementary bases. sand base pairs where there are:known differ- ences between people. These base pairs. about 3.2 billion strong, repre- sent a whole DNA molecule or what is referred to as nuclear DNA (nONA). All cells in the body What is a base pair? contain DNA. except for red blood cells. which I do not have a nucleus. DNA in blood comes from Picture the DNA molecule as a ~piral staircase G (see Figure 2). The bases A. C. and T behave in the nuclei of white blood cells. a precictable pattern of matching and becoming base pairs. A base pair is simplyia pair of bases. I t I Ul~i-1 bi-1~10' I HE SCIENCE OF DNA • CWUJ Figure 3: DNA in the Cell Chromosome ~//!'· Double-stranded DNA molecule ·~· ;~~ Source: John Butler. National Institute of Standards and Tecnnology -0 was:asaa:asuaw:I&OO Bacl< to high school biology coding for eye cplor or the potential predispo- sition toward a genetically inherited disease)' Picture a chicken egg. An egg is like a cell. -except for armelogenin, which is used in except that an egg's outer shell is smoother and forensic analysi for gender differentiation. more symmetrical than a cell's outer shell or The areas at wh ch forensic analysts look are membrane. The yolk of the egg is comparable to always found in the same spots on the same the nucleus of a cell. The DNA is located inside chromosomes. ach specific location is called a the nucleus (see Figure 3). The DNA in a single locus (pronounc d "LOW-cuss"). The forensic cell is over 6 feet long and is bunched up inside science commu I ity typically uses a minimum ·the nucleus of each of our nucleated C"?lls. In of 13 genetic lo~i (plural for locus. pronounced order for DNA analysts to be able to conduct test- "LOW-sigh"), referred to as the 13 core COOlS ing on DNA. they must remove the DNA from the (Combined ON~ Index System) loci. This enables other cellular material that is present. using a pro- · laboratories to s.earch profiles against other pro- cess called DNA extraction or DNA isolation. files already in the COOlS databank (although some laboratori~s test more than the 13 core Human traits are determined by the particular COOlS loci). Thrbughout this training guide, refer- order of the bases. The first thing the order dic- ences will be made to the 13 core CODIS loci. tates is that we are human. Second. the order of the base pairs dictates all the physical traits These core COOlS loci are CSF 1PO. D3S 1358. we are born with (such as eye color. face shape, 05S818, 07S820, 08S1179. 013S3J7.D16S539. etc.). In addition, there are base pairs that do D18S51, 021 S1i1. FGA. TH01. TPOX, and VWA not "code" for anything and pairs whose coding (TPOX is pronoJnced "T-Pox ... VWA is pro- functions are not yet known. nounced V.W.A. Likewise. FGA and CSF are sim- ply pronounced py their individual letters. THO 1 The DNA looked at in forensic science is not is pronounced "~ho One." with a hard "th. "). currently known to have any function (such.as i ' . . .. . . ' ~ lj@ijj IJ~tifi-K-~J!~'i&iie·etK4kn#~:.«~~~w.ieoW&~~;ilw&¥~~: INITIATIVE CHAPTER 2 ;....;.J._..~·····"~>M-::~-,;-.~~~ For the "D" loc1. the number following the D for Cl pattern at a specific location on the 11th ivvh1ch s1ands for DNA! tnd1cates the chrome- chromosome. The pattern looks like this AATG some on which each locus is found. 021 S11. V'!e know that everybody has the same AA TG for example, is a complete name. which lawyers sequence on the DNA molecule at THO 1 Tr1e refer to as 021 tor 1dent1ficat1on. Here "21" difference between individuals is how many refers to the 21st chromosome. S corresponds times the pattern AATG is repeated on both of 10 the v;ord ··singie'' -meaning there 1S oniy their 11th chromosomes. Some people have a one copy of !h1sgenet1c marker in the huma'l pattern of the four bases AATG repeated five genome. and the number following the S refers times. and their DNA type, or allele. for that copy to \.Yhere tillS lOCUS rS IOUild on the 21St of the;r 11th chrOmo.some would look iike thts tf ct1romosome. it was sequenced by bases AA TGAATGAAT G AATGAATG. Other people. however. have otner Each of the 13 loci was chosen because of rts alleles -and the person with five repeats on high degree of po!vn~orp!·,ism, meaning that one of their 11th chromosomes may have a several different possible genetiy types exist for completely different repeat on their other 11th each locus. By examining and identifying these chromosome. For example. the sequence AATG differences, scientists in the laboratory can dif- AATGAATGAATGAATGAATGAATGAATGAATG ferentiate between people. To illustrate, the loca- shows the pattern of four base pairs repeating tions on the DNA molecule that dictate for .the .nine times. This allele type is a 9. If one addition- nose to be in the center of the face are essen- al four-base-pair pattern were repeated, the allele tially ident1cal among us all. On tre other hand, type would be a 10. the genes that dictate the shape; of one's nose are poiyr;,orphic. All you have to 'do is look at 10 So what's a 9.3? Although most of the time people to know that the DNA we are looking at involves a repeating pattern of four base pairs. sometimes- 9.3 at At each core COOlS locus. the possible types TH01. for example- this is not the case. We one can have are labeled by nuniber. At TH01. already know that. at this locus. nine repeats of for example. the types that havei been observed AATG constitute a 9 allele type and 10 repeats are 5. 6, 7, 8, 9, 9.3. 10 and 11. tenerally, each make a 10 allele type. A 9.3 reflects nine repeats person onthe planet has two of hese: one from of AATG and an additional three bases minus one mom and one from dad. These t pes are referred of the As. ATG. If there was an additional A in the to as alleles (pronounced "uh-LEELS"). If the two same predictable pattern, we'd call it a 10. but alleles m a profile are identical (in other words because some people have ATG in addition to the person received a 5 from mdm and a 5 fr;m nine repeats of AATG. an allele type of 9.3 exists. I dad), they are homozygous. If the two alleles are different, say, a 5 from mom and an 8 from dad, Not every locus has the repeating pattern of they are heterozygous at that locus. Rare muta- AATG, but 'every STR locus does have a repeat- tions can and do occur (see. for example, www. ing pattern of base pairs that we look for to iden- cstl. nist.gov/biotech/strbase/). tify the allele types for that particular locus. ~:lmrt tandem repeats (STRs) How are loci of interest found? The numbers identifying the alteies for the core Let's continue to use TH01 as an example. We CODIS know it is on the 11th chromosome. and we . . loci reflect the number o1' repeated base pair seQuences at that locus. Re81ember. the know where it is on the chromosome. In the locus is polymorphic- it varies trom person to iab. DNA test kit reagents .are combined with person. The way it varies is in it~ length. A per- a portion of the DNA obtained from a sample. son who has a type 5 has a much shorter length The reagents have several jobs. One is locat1ng of DNA at that locus than a persbn who has a the areas of interest (the loci) that we wish to type 10. ! test. Pnmers run along the strands of the DNA I molecule, looking for the loci we care about. The For example. at TH01. we are not just look- primers then identify the DNA strand immedi- Ing at the 11th chromosome; we are looking ately before and ·immediately after the region of -~~~f!!~1:T'"'~~~~~!f;k!%9'\Y.#.f:}iit"Mk¥~;:\"~~~~fl~$. ~)~'ft.~ (p DNA BASICS: TRIAL ISSUES , 0 And 11 doesn't teii us when that happened. analyst should concede these po1nts easily; they where it happened or how it happened; isn't may be worth exploring on cross-exam1nat1on that true? 1f the defense theory suggests contamination. A. Yes. transfer or the innocent presence of the defen- dant at the sce~e at a different point in time. FOR CASES INVOLVING THE INNOCENT DEPOSIT OF DNA: Many labs do n~t attempt to distinguish between vag1nal and skin cells. A scientist may be able 0. The DNA :est results can't tell when the to obtain a DNA profile but not be able to testify DNA was left; 1s that correct 7 that the source definitely was vaginal fluid or A. Correct. skm. Contrast tf\is with the confirmatory tests for semen. Most of the time. scientists can conf1rm ' 0 The DNA test results can't tell you the time that the DNA profile came from sperm cells. it was left; is that correct? A. Correct. The defendant's DNA may have come into con- tact with an item of evidence through contamina- 0. The DNA test results can't tell you the date tion. As a preliminary matter. counsel should look it was left; is that correct? carefully at chain-of-custody logs for eve.ry step A. Correct. of the process ~ from the crime scene to the laboratory to th.e analyst's workstation, and any other movement or handling in between (includ- 0. The DNA test results can't tell you whether it ing any time eviidence was removed from stor- was deposited consensually; is that correct? age and then r~turned). If the defendant's known A. Correct. DNA sample was handled on the same day as. and in particula~ before. an item of evidence ~ If defense theory favors opposing the govern- wh1ch the labo~atory's protocols may prohibit ment's claims regarding the DNA evidence ~there may be reason to think that the defen- -that is. if the defense theory is that the d-efen- dant's DNA wa~ transferred to the evidence dant's DNA is not where the prosecution says through misha~dling. If the defense theory is that it is - then cross-examination of the govern- the DNA was contaminated, counsel should pro- ment witnesses may be the primary strategy ceed with caution and be prepared· to elicit evi- for undermining the evidence and showing the dence in support, through either the DNA analyst jury why they should discount it. The goal of the or others who ¢ame in contact with the evidence adversarial cross-examination should not be to during the chain of custody. spar vyith or outwit the expert but. instead, to systematically highlight the shortcomings of the Under either a ~ransfer or contamination theory. procedures that led to the DNA report asserting counsel will want to find a compelling way to that, for example, the defendant's DNA profile illustrate to jurors how little DNA is required cannot be excluded as admissible evidence. for it to register on the analyst's instrument. Depending on Which DNA testing kit is used. one nanogram or l!s is considered to be an optimal Time, place, transfer and contamination amount of DN for testing. Defense attorney In most cases- except some sexua! assault Bob Blasier fa . ously illustrated this concept: cases - analysts cannot say exactly when or Hold up a pack~t of sugar and note that it con- under what circumstances DNA came into con- tains approximftely 1 gram of sugar. Assume the tact with a piece of evidence. DNA at a crime ~acket. contain~ 1,000 individual granules. Con- scene may have been left there days, weeks or firm w1th the ahalyst that given this premise. to months before the crime. or after the crime was obtain a nanogram of sugar they would need to committed. A person or object may have trans- divide a single crystal by 1,000, and then divide ferred the DNA there. If the defendant's DNA is one of those pieces by 1,000, and then again. present at the crime scene oron an object recov- Finally, the expert will agree, you are at 1 nano- ered from the crime scene. this does not mean gram, or less than the eye can see- and that with any certainty that he or she was present at amount, or less. is all that is needed for a per- the crime scene at any time. The government son's DNA profile to appear in a test result. That CHAPTER 8 ·" ·-~iJi.'iftfs~iU+'M*WZ, ar:~:::>•,,r.T of DNA n11ght be transferred by a sma!! w1th a trad,tJonal rardom match statiStiCal ca1cu· nL:":ce' of sk1n eel's that came 1n contact wi:h Jation can address drrect!y; however. some labo- a person or ObJeCt. which later came in con:act ratones now use source attr10Ut10n staternen~s 1n wtr. another object If counsel picks up a pen their DNA reports. A source attribution statement 1n the courtroom. the expert will probably agree is used to definitively state that. !o a reasonable that there IS a fair chance that co.unsel's DNA IS degree of scientific certainty. this DNA profile now on that pen by way of shed ~kin cells. ong1nated from this person. or the1r Jden:1ca! tv.:rn Source attribution teStlmOrty must actL.al!y In sr,ort. miniscule amounts of DNA can be trar,s- re!y on demonstration via a statist1cal calculation ferred easdy. Th1s line of cross-examination can i;yp1ca!ly 1n the case notes) that the obta,ned be effect;ve under a theory of simple transfer or Df~A profile meets or exceeds the value set by contam1nat10n. Factors such as evidence packag- the lab 1n order to make such a statement. The ing, handling and cham of custody are critiCal to defense's expert should be able to assist counsel developing the facts necessary to support su::h a in locating the statistical data and publications on theory wh1ch the lab relied to reach ItS conclusion and design appropriate challenge questions. Statistics coth~e_!i~tions~l"l.f(~07 Unless there is an opposing legal ruling, to be in compliance with the current SWGDAM Guide- Another potential area for cross-examination is lines, a DNA analyst should be p~esenting a sta- that the inculpatory claims are being made on tistic to charactenze the significapce of a match the basis of a finite number of genetic locations involving DNA found on an item d>f evidence and -most typically, ,the=l3-c·ore·CODTS~Ioci~fie,15 someone involved with the case.! In non-mixture STR loci in the ldentitilere. l<if,orthef5 ·sTRioci cases- and often in distinguishable DNA mix- in the PowerPiex® 16 kit - of the literally billions ture cases -that statistic will take the form of a of genetic locations comprising the complete random match probability. as discussed in Chap- human DNA chain. ter 6. Section 7. In an indistinguishable mixture case. the statistic will likely take the form of a The entire human DNA genome for each person combined probability of inclusion !CPI), a com- is unique (even identical twins). In forensic DNA bined probability of exclusion (CPE). also called testing, however, only a finite number of auto- random man not excluded (RMNEL or a likeli- somal STR genetic markers are examined (as hood ratio (LR). noted above, typically 13-15 areas). Research strongly supports that it is necessary to examine One section of the adversarial cr<;>ss-examination 10 or more of these areas of DNA in order to be should focus on the analyst's statistical claims. able to distinguish between people. even those It is important to dispel what is khown as the who are related (with the exception of identical prosecutor's fallacy, which is a cCDmmon misin- twins. who will have the same autosomal STR terpretation of the random mate~ probability sta- DNA profiles). The prosecution's expert should tistic. If the probability that a ran~omly selected concede that other genetic loci developed for individual would match the DNA profile found at forensic identification were not used in the cur- A . ---- --~ _.:..._ the scene is 1 in 1 trillion, that does not mean , rent case. l~?!fenoantw~"ll e--=~~~u~ed..:E.Lil.l55 that there is a 1-in-1-trillion chande that the DNA ~:one~~f_::!b_ose-ot~~~--l~catio~!Jtle~_e~~ert-~_9.~d. _. , came from someone other than the defendant. ~h_ave·to agr~(lt tb_e._Q~~m(,!~Lf:la_vEl_::_.ongtna_t~cj.) It means that if a person is picked at random out c)rornaO..Q:tnet_p_e;~ - however. the analyst did of the general population. the probability that he not test those other locations. Defense counsel or. she will match the detected profile is 1 in 1 should be aware that forensic scientists within trill1on. a laboratory use whichever commercial test kit their laboratory protocols specify. Although The question of "What is the probability that the there are a number of kits available that test for evidence DNA profile came from the defendant additional genetic markers beyond the 13 core is not one that DNA testing thatis supported CODIS loci. not all labs use the same kits. !~·~~:Y-'~~·~:~~~~:r.-~!~~·~1~-rF'~i'F~~y~'!'J~f>~·~y~~·~~~·~~::.~r~"flTTF·':~:ri:' 1t} • INITIITIVf Section 1: Statute of Umitat;ons which DNA evidence exists and has been preserved. [6] Defenses Statute of limitations legislation serves a number of purposes: Section 2: John Doe V\farrants Typically, the period of limitations is tolled when [T)he applicable statute of limitations ... is ... a charging document with some information the primary guarantee against bringing over- about the perpetrator's identity has been prop- ly stale criminal charges. Such statutes rep- erly filed. "John Doe" warrants- warrants resent legislative assessments of relative without a known name but with some identifying interests of the [s)tate and the defendant in information - have begun to be used, particu- administering and receiving justice; they are larly in DNA cases. made for the repose of society and the pro- tection of those who may [during the limita- The first issue i~ whether John Doe DNA war- tion) ... have lost their means ~f defence., rants satisfy the: "particularity" requirement of the Fourth Amehdment or parallel provisions · From the defendant's vantage point. there of state constitutions. Generic descriptions of is particular "concern that the passage of suspects generally do not meet this standard.' time has eroded memories or made wit- However, courts that have considered the issue nesses or other evidence unavailable. " 2 to date have found that John Doe warrants with a numeric DNA profile as the identifier meet the The following principles of law are not in dispute: Fourth Amendment standard. 8 ll Once the period for commencing prosecution A separate argument contends that a warrant has expired, it cannot be retroactively extend- should give notice to the perpetrator so that he ·. ·- -·.. ed by new legislation. 3 or she can gather evidence and prepare to meet ii This is true even in cases where DNA evi- the charges. Clearly, a DNA-profile warrant does dence conclusively establishes identity. [4] not give notice to the average citizen. H~;vx~v~r. the one court to consider this claim tQ.,.cl~t~;·has If! Conversely, when a legislature extends the rejected it. 9 This type of claim yy().uJ~:aP,P)y;'9nly in statute of limitations for a particular criminal states where the statute o.1~,\iJ1\~~~t.~c;).Q~~r~~:.been act before it expires. the extended period extended but n$t elimi~e:p~~.~.~:r~iW9.:U1d be applies and no statute of limitations defense no claim of entillerQJ~.qf~~·~iji~!!.ce in ~tates applies. 5 where the legislature has .abolishe~La part1cular The advent and success of using DNA to prove period for comfencing prosecution. identity - particularly in sex crimes with biologi- cal material -' have led to legislation changing the time period in which specified crimes may be prosecuted. In some instances. the time period has been lengthened or eliminated entirely. An Regardless of whether the limitations period has extended period has been granted in cases in been extended or abolished, delayed prosecution may raise due process concerns if the right to CHAPTER 9 ·:..:.::.:.·~"~'"l¥;n-;=t.~ll.'li9Jllilli!IIIG"&F present a defense has been severely compro- and compare qualifying DNA profiles on the mised. The U.S. Supreme Court has explained national level. Profiles deemed "allowable" by · that the Fifth Amendment requites the dismissal NDIS are then searched against profiles from of an indictment- even if it is ~rought within all other SDIS participating labs accepted at the statute of limitations - if the defendant can the national level. As of August 2010. NDIS prove that the government's delay was a delib- had more than 8.7 million offender profiles erate device to gain an advantage over him and and more than 330,000 casework profiles. :4 that it caused him actual prejudice in presenting Ill SDIS- the St2~e Df~A .ndex Systern- his defense. ' 0 allows laboratories within each state to exchange DNA profiles. Each state has a The difficulty in applying this test is twofold. single statewide databank- SDIS. The FBI First. it requires proof of the prosecution's ill serves as the SDIS lab for the District of motive in delaying, unless state law is more solic- Columbia. The U.S. Army Crime Lab is also an itous.'' Second, the prejudice must be substan- SDIS lab. Each SDIS Administrator acts as the tial.12 Nonetheless. it is an issue that warrants gatekeeper for determining the acceptability, examination in any case where there is a signifi- based on that state's guidelines. of profiles cant gap between commission of the offense submitted by each of the state's LDIS labs. and commencement of actual prosecution. Profiles accepted by the SDIS Administrator can be searched against those entered by other LDIS labs in the same state. Profiles Section 4: The Databan1 Hit Cas.e accepted by an SDIS lab will also be searched against the convicted offender and arrestee (when applicable) profiles entered by the SDIS Overview of the CO DIS DNA ,atabanks I lab. SDIS cust~dians can share their data with In 1990, the FBI Laboratory began a pilot project the national CO"DIS community by forwarding called COD IS, creating proprietary software that it for consideration for inclusion in NDIS. enabled and continues to enable federal, state m LOIS- the Local DNA Index System- is and local laboratories to electronically upload, the databank where regional, county and exchange and compare DNA profiles. · municipal labs within a state enter their pro- files. Bench-level DNA examiners, or the lab's The Federal DNA ldentificationAct was en.acted designee, use ·CO DIS software to enter DNA as part of the Violent Crime Conlrol and Law evidence profiles into LOIS, where they are Enforcement Act of 1995 {Public Law No. T03- searched against other profiles that have been 322). This law authorized the FBI to establish a entered previously by their lab. Local labs can national DNA index for Jaw.-enfo~cement. Since then forward their profiles to the state level then, federal and state governments have invest- for consideration for upload. Local labs must ed significant resources toward ~eve loping and go through their SDIS lab to get profiles into maintaining a national databank ystem. NDIS the national level of CODIS. became fully operational in Octo er 1998. The three-tiered system allows state and local ' CODIS users predominantly access two indexes: agencies to operate their individual databases the forensic index and the offender index.' 3 The within the confines of state laws. which vary by forensic index contains DNA profiles from crime jurisdiction. The exchange of information within scene evidence. The offender index contains this secure system is controlled by and strictly DNA profiles of individ.uals who have been con- limited to law enforcement. victed of offenses defined by state or federal law. The FBI maintains the COOlS databank. COOlS allows for the entry of qualifying DNA profiles into indexes based on specimen catego- CODIS has three levels: ries. The most commonly used specimen catego- ries are as follows: !!!! NDIS- the National DI\JA Index System- is the highest level in the COOlS hierarchy. It • Convicted offender: DNA profiles of people enables participating labs to upload, exchange convicted of a crime.

/

0 El AYE 0 P R 0 SEC U T tONS AN 0 C 0 l 0 CASE H fi!!t!'!?.f+Jtmt~;-~~W.:!Aflt'...,.J/IWtF!iJIItiMi1Wr:¥.~~1!i!.'iit&.,OJ.i~4:i!"£!M4i.A.OI~J.]:i

1r Forensic: DNA profiles developed from crime Forensic DNA databanks were originally limited scene evidence. to samples only from adults convicted of felony sex offenses and a few other violent crimes. £' Arrestee: DNA prof.iles of arrested persons Databanks have: now been expanded to include (if state law permits the collection of arrestee many other offenses as well as other classes of samples). offenders. All 59 states. the District of Columbia. c: Missing persons: DNA profiles from missing and all federal jurisdictions now require certain persons- either known or deduced to be classes of convicted offenders to prov1de a bio- · known profiles from missing persons. logical sample for entry into a DNA database. Each jurisdiction's statute determines whether a E Unidentified humans: DNA profiles from person convicted of an offense will be required recovered unidentified human remains (UHR) to submit a biological sample for inclusion in a as well as from humans who are unable or DNA database. (For more information, see http:// unwilling to identify themselves. forenslc.dna.gov/module9/1/.) The trend is clearly El Biological relatives of missing persons: moving toward including larger categories of DNA profiles voluntarily contributed by rela- people, including those with misdemeanor con- tives of missing persons. victions, juveniles and arrestees. 17 Other databank indexes exist (such as those that CODIS contains limited information, s~ch as a contain RFLP profiles). and the ability to enter specimen identifier, the sponsoring laboratory's mtDNA and Y-STR data has been added for cer- identifier, the initials or name of DNA personnel tain specimen indexes. Federal and state laws ass~ciated with the analysis, and the actual DNA govern access. disclosure, compatibility, expunc- 1 ~rof1l~: Depen~ng on lab protocol, the specimen tion and penalties for unauthorized disclosure of 1dent1f1er of. pro iles submitted to the forensic information contained within CODIS. 1s (ca.sework) 1nd x may identify the type of bodily flu1d, whether t~e source is known, and/or The DNA Identification Act of 1994. which estab- whether the entered profile was deduced from lished NDIS. also created the DNA Advisory results of mixed-sample DNA typing. CODIS . Board (DAB) to develop standards for quality does not store criminal history information or the assurance. The board's work culminated with names of convicted offenders/arrestees. the promulgation of the first set of standards document for the forensic DNA casework analy- When CODIS software recognizes the same SIS community, which became effective national- DNA profile in the forensic and offender indexes. ly on October 1; 1998, issued by the FBI director. it identifies the two profiles as a match. These These standards superseded the existing matches are commonly referred to as "hits." TWGDAM Guidelines that had previously been Qualified personnel from both involved labs then used as the guiding document by forensic DNA analyze the reported match to either validate or labs. A second set of standards for convicted refute it. This critical review of all matches is offender databasing laboratories. which became standard operating procedure and is used to effective on April 1, 1999, was issued by the ensure that a rriatch produced by a search of the DAB before the group disbanded on March 9, databank "mak_rs sense." With a hit generated 2000. Currently, the responsibility for maintaining by a search of ~ODIS that involves a 13-loci · the Quality Assurance Standards (QASJ docu- match betwee~ an offender profile and ·a single- ments falls to the director of the FBI. Recom- source evidenci3 profile, the review process is mendations for updates are provided by the fairly straightfotward. Once both labs have Scientific Working Group on DNA Analysis Meth- agreed that the1profiles do indeed match, the ods (SWGDAM). 16 convicted offender lab will then research which offender corresponds to the specimen identifier To participate in NDIS, states must sign a Memo- in its system and will pull the corresponding sam- randum of Understanding verifying that the sub- ple and rerun it to confirm that the archived sam- mitting laboratory is in compliance with the FBI's ple bearing the offender's name generates the quality assurance standards. same profile as the one entered into CODIS for that individual. This quality check is to ensure CHAPTER 9 that sample results were not inadvertently investigations and share leads. even across mul- switched during analysis or data entry. Once the tiple jurisdictions. profile has been confirmed in this manner, the convicted offender lab will subsequently provide basic information regarding the offender, I such as Introduction: The hypothetical databank name,. available Department of Corrections I infor- hit case mat1on, and recorded date of birth, race and sex to the casework lab. The casework sample lab A woman alleges that she was raped. but she will then issue a hit report to the investigating cannot make an identification and the police do agency to notify it of the databank match. This not have a suspect. Semen found in her vagina is report typically requests submission of a newly typed for a DNA profile. and the profile is devel- obtained buccal sample from the identified oped and entered into the state's DNA databank. offender to the casework lab as another quality It is compared with the profiles in the convicted check to ensure that a DNA profile obtained from offender databank, and there is a match with the the offender does indeed match the profile gen- defendant. The police use this hit as probable erated for the evidence profile. This report should cause to ultimately take the client's DNA sample, also specify that the hit information is only which is then tested and compared with the evi- intended to provide potential investigative leads dence sample. This may result in prosecution but that must be pursued by the investigating agen- could result in a delayed prosecution when the cy. If subsequent investigation supports that the following occurs: COOlS match is meaningful, this' can be used as the basis for probable cause to 1tain the IIi The testing by the lab is conducted well after requested biological sample fro the offender. the alleged incident occurs. a The testing is conducted and the databank There are times, however, when the DNA profile match occurs, but the suspect is not available generated from crime scene evidence that has to provide a sample for direct comparison with been entered into CODIS is a mixture of more the evidence profile until later. than one person's DNA. In those cases, the ana- lysts will still critically compare the profiles to see 11 The databank hit occurs in reasonably close if the offender's profile is included as part of the proximity to the alleged incident; however, it ~ mixed DNA casework profile. It is not uncom- takes a while for the government to build a mon in these circumstances for the analysts case for prosecution. to dismiss a match proposed by COOlS as not


4 Ch. 411 SUBCHAPTER G. DNA DATABASE SYSTEM, refrence to § 411.142. DNA Database (b) (f) (g) (h). (3) State's Exhibit #105 Texas Department of Public Safety Physical Evidence Submission Form and State's Exhibit #106 Serologist Orlando Ochoa's DNA Test Results conducted December 12, 2001. (4) McAllen Texas DPS. Crime Field Laboratory Shut-Down. News Paper articles of audit conducted. for allen Texas DN me 1e Motion ·-=-on uct a "court of Inquiry'. (6) Newly Discovered·~~orensic affidavit evidence from forensic analyst Harry J. Bonnell and Jonh Plunkett. (7) United States Department of Justice , Office of Justice Programs, National Institute of Justice letter and publication of "DNA For the Defense Bar" substantiating 13 loci search and match. IN THE 13TH COURT OF APPEA ! CORPUS CHRISTl REPORTER •c;: RECORD JUN- 5 2003 VOLUME i- OF TI TRIAL COURT CAUSE NO. CR-3196-0¢.AJIHY WI BY ---?JU----; THE STATE OF TEXAS § IN THE DISTRICT § vs. § HIDALGO COUNTY, TEXAS § GUSTAVO MIRELES § 332N° JUDICIAL DISTRICT REPORTER'S RECORD Trial on the Merits On the 6tb day of August, 2002 the following · proceedings came on to be heard in the above-entitled and numbered cause before the Honorable MARIO RAMIREZ, Judge presiding, held in Edinburg, Hidalgo County, Texas: Proceedings reported by oral stenography. RACHEL M. KRAM, CSR OFFICIAL COURT REPORTER 92N° JUDICIAL DISTRICT COURT 100 N. CLOSNER EDINBURG, TX 78539 13-1- (956) 318-2250 '· ORIGINAL ",. : C~ Ll': 2BEn JUii - (E) .. 1 A. Those are used as a reference or known 2 standards that·we use to compare to unknowh evidente '•. 3 t ha,t ..r we receive. /' 4 / Q. Concerning the two blood lifts from the / 5 outside of the Chevy pickup truck, the bldod ~tain 6 from the victim's jeans, and the black hair that you 7 recovered in the purse, could you determine who was .." 8 the most likely contributor of that DNA? / I I 9 A. Yes. I 10 Q. Who is that? 11 A. It is consistent with the suspect. 12 And when you say consistent, how do you 13 determine if i t ' s consistent? I . I 14 A. Again, we'.r.e· looking at the different regions I • o·f the DNA and comparing them to the differen-t --'-'>to the regions of the DNA to the known standard from the suspect. Q. And the hair that you tested there was the pubic hair? A. That is correct. Q. What is the chance that the contributor of the DNA is the defendant? MR. VILLARREAL: Objection, Your Honor, asking the witness to speculate. ~ 25 THE STATE: Your Honor, he provides the Rachel M. Kram, CSR 92ad Judicial District of Texas ?.() (E) . Q ~ 1 same information in his report and it's part of the 2 same scientific testing he conducted. 3 MR. VILLARREAL: Your Honor, the 4 specificity of his report is based on six million . ~·, people -- I'm sorry, I believe six billion people worldwide. We're talking about 147 billion people, which exceeds the six billion that are in the world alone, so where is the basis there? And more importantly, Your Honor, that did not allow for th~ specific races, Caucasian, Negroid, Afro-American, ~nd Mexican-American or Hispanics. THE COURT: The objection is overruled. Q. (By Mr. Schammel) When you make your comparison, do you factor -- do you base the ·comparison based upon different races and the probability that that DNA will appear in different races? A. Well,·we do. Once we get a DNA profile -- MR. VILLARREAL: Objection, Your Honor, becoming nonresponsive; calls for a yes or no answer. THE COURT: Sustained. (By Mr. Scttammerr--·wha t 22 23 Q. . -· the res u 1 t s ? -------· a~·-yo-n 2 A .. We provide a probability of a match. ,. ' And what is the -- what do you use as Rachel M. Kram, CSR 92ad Judicial District of Texas ,.. \ ._.;.--- ;.' o- c., ~ )y 1 for the probability of the match? ~~ 2 A. It's a data base,. it's a computer system that 3 we use where we ~nter the DNA profile that we obtained 4 from the evidence and it provides us with a .·::-, statistical value. Q. Does that statistical value -- is it correlated for different races or is it for the world in general'? A. It -- i t ' s divided into different -- three different races. Q. Which races is it divided into'? A. Caucasian, Blacks, and Hispanics. Q. What is the chance of seeing the DNA profile what is the probability of a person be~ng the source of the DNA profile that you obtain~'? A. The -- for which items'?. Q, For the blood stains from the Chevy pickup, the blood stain on the victim's jeans, and the pubic hair found in the purse. A. ' For -- the DNA profile that was ~btained from 21 the blood stain of the Chevy pickup, the blood stain 22 from the victim's jean, and one of the pubic hairs 23 from the black purse, the probability of selecting an 24 unrelated. person at random who could be the source of ~ 25 this DNA profile is approximately one in Rachel M. Kram, CSR 92 d Judicial District of Texas THE COURT: That's sustained. A. Carr ---let· me -- THE COURT: Wait a minute. Go ahead, Mr . S c h a mm e 1 • ~- Q. (By Mr. Schammel) Given the population of the world, how likely is it that this is the -- that the defendant is the person? A. Again, one in 1 trillion-168 billion for Caucasians, one in 301 trillion-700 billion for Blacks, and one in 147 billion-300 million for Hispanics. Q. Now, was there any other DNA that was obtained from any other items? A. Yes, there was. I- . 15 Q. Was there any other DNA obtained from items 16 that matched the defendant? 17 A. Yes. 18 Q. 19 A. A se hair from the 20 being the person who contributed that DNA sample? 22 A. One in 34,230 for Caucasians, one in 181,900 23 for Blacks, and one in 24,180 for Hispanics. 24 Q. Now, why is there a var~ance from that 25 particular hair, the DNA you obtained there, compared Rachel M. Kram, CSR 92Dd Judicial Distri f Tex 1 to the DNA you obtained on the other hair? 2 A. Yes, because we're looking for, as I mentioned 3 earlier, we're looking for various reqions of the DNA. ' .... , 4 Wfl'~e testing various regions, nine regions of the DNA plus the sex chromosome that allows us to Heterrnine if the -- the body fluid comes from a male or a female. 7 Depending on how many of those regions we're able~ 8 recover doing our DNA analysis and do a comparison, 9 the numbers may vary. In other words, if we get a 10 full profile, if we're able to get all nine regions to 11 come up and give us a profile for the spec~men or for 12 the body fluid, then we're able to compare those nine 13 regions and get a better number whereas if we were to :14 compare -- because we only got two -- two or three of the regions, we're not able to compare as.mani regions of the DNA so we're not able to get the more 17 specific -- or the more specifiG statistical 18 Q. What are some of the reasons that you would 19 obtain less than all nine of these points that you're 20 lookiQ.g. for?-···-····-···-··-··-·---··-·· A. Again, the conditions of the body fluid, of • the evidence itself. Well, was there degradation of the DNA, were there dyes or chemical that might have interfered with the technology, the DNA processing. Q. Was there any other DNA obtained in this case? ..... -·""' _____/ Rachel M. Kram, CSR 92ad Judicial District of Texas ~~ ( (c) 0. q -------....;.;:::..-_ -/ 1 A. Yes, there was. • . • • ~ a, •• .......... 2 Q. And was there any of.that DNA~t matched the '· 3 victim in this case? 4 A. Yes, there was. 5 Q. What specifically did you find that matched). 6 the victim? \ 7 A. A hair obtained from the victim's socks and I 8 blood from the victim's fingernail scrapings. 9 Q. And these were consistent with Mary Jane? 10 A. Correct. 11 Q. And what is the likelihood .... that she was the 12 person that l~ft that DNA there? 13 A. One in 28 for Caucasians, one in nine for 14 Q. Now, this is extremely low. that? A. The blood itself that was recovered from the victim was not letting itself to DNA analysis, so I ; 19 wasn't able to get a complete profile from the known 20 blood. It appeared to be diluted. It could have been 21 caused by -- during the autopsy or something that it . I might have been diluted out to where I wasn't able to get g.~d DNA. ,..::...... .. ... .. ---·· -··------·· 24 Q. As to the blooo· under the V~ctim' s fingernails ~ 25 and on the hair from the sock, you can say that the Rachel M. Kram, CSR 92DdJudicial District of Texas . ! VoL 9. • J defendant is not the contributor there? A. Yes. Q. Now, were there any items on which no DNA was recovered? A. Yes, there was. Q. Several? A. Yes. Q. The screwdrivers and knives that were admitted, was there any blood or other DNA evidence recovered from those? A. There was no blood detected. Q. As to the drill bit also? A. Which item are you referring to? Q. Item number 42-B on your list. It would be State's 73-B. A. No blood was detected. THE STATE: Permission·to approach the witness? THE COURT: Yes. Q. (By Mr. Schammel) Let me show you what was previously marked as State's 85, and it was previously • 22 testified that there is nothing inside of State's 85. \?3 Do you see anything there? '· 24 ... _ . A. No . 25 Q. What was the laboratory number on State's 85? Rachel M. Kram, CSR 9lad Judicial District of Texas . ! B lo[. ~- Q. So if you look at other places, you might hav\ been able to find someone else? \ A. You're going to -- the probability, again, would be that you would find that pr?file in another individual. Q. So if we got 31 people in there, there's a I probability or a possibility that one of us did it? A. Or that one of you has that DNA profile. like you mentioned with the DO alpha that i t ' s one region and that's why you get the statistical values of one in 14, I believe you said, one in 20- -- Q. One in 28 total and in Hispanics is one in five. A. Right. And so that's why we --we look at more than one region, more than two regions. We look at nine, ten regions up to 13 regions to make it more specific to an individual. It's --for example, if you don't mind me explaining a little bit more. I t ' s 1 i ke , f or e x a ~p 1 e , you're looking for an individual. Well, you're looking for a female, so that's going to cut out all the males. You're looking for a female that is .. looking five foot -- five feet, so that's going to cut out everybody that's not five feet. So the more ' 25 things that you look at, the ·more specific it becomes Rachel M. Kram, CSR 92ad Judicial District of Texas ,, ~ , ,_'l /.J L • } '1 ij '\!._' \C'j 1 is. That's not -- 2 Q. So if the stain was two weeks old, yo~ 3 couldn't tell the difference between a two-day old and 4 a two-week old stain, would you?_ 5 A. That's correct. --··· 6 Q. And if the stain were let's say contaminated 7 as you say the victim's blood was, which you could not 8 type -- is that correct, you could not type her 9 blood -- or you found no DNA? I 10 A. It didn't give u~ -- it didn't give us all of ~ I 11 the regions that we looked at or that we amplified. 12 Q. Which means you got negative results on her 13 DNA? 14 A. On some of the -- we got like maybe two locus ~ 15 out of 10 loci that we looked at. 16 Q. Let's talk plain English. 17 A. ~· "l ~ 18 Q. You didn't match her own blood. 19 A. We didn't match her own blood? 1 20 Q. Yeah. 21 A. That's not-- npt necessarily true. 22 Q. But is it possible? 23 A. That you're not matching 24 Q. Could you put it that way? 25 A. That you're not matching someone's blood? Rachel M. Kram, CSR 92od Judicial District of Texas Q. Yes. A. Well, if you're obtaining the blood from t: individual, you know that that individual -- it belongs -- or that blood belongs to that individua Q. That ' s common s ens e , i sn' t it ? A. Yes. Q. But if DNA says according to -- and is use a known standard, your item number 22-A, blood fro victim, however the blood was not suitable for DNA I 10 analysis. Common sense says i t ' s her blood. 11 ~------------------------ Q. But DNA says it's not. A. N~t -- it'~ not saying that i t ' s not her blood. It's saying that it wasn't able to provid~ with -- Q. See, we've been playing word games with th other A. THE STATE: Objection to the side bar Your Honor. Q. DNA THE COURT: Hold on. MR. VILLARREAL: I apologize, Your He and to the jury. Rachel M. Kram, CSR 92ad Judicial District of Texas ;~ _- § 411.1405 F..xECUTIVE BRANCH DEPARTMENT. OF PUBLIC SAFETY § 411.142 \ Title 4 .Ch.411 (c) A state agency that obtains criminal history recon~ information under this SUBCHAPTER G. DNA DATABASE SYSTEM section may not release or disclose the information or any documents or other records derived from the information except: CroSs References (1) by court order; Community supervision, conditions, submission of sample for purpose of creating a DNA record, see Vl'fllon's Ann.C.C.P. art. 42.12. · ri\ (2) with the consent of the person who is the subject of the .information; or (3) to the affected <;_ontractor or subcontractor, unless the" information was § 411.141. Dellnitions ~ obtained by the department from the Federal Bureau ~f Investigation. In this subchapter: (d) A state agency and the affected contractor or subcontractor shall destroy (1) "DNA" means deoxyribom.icleic acid. criminal history record information obtained under this section that relates to a person after the information is used to make an employl:nent decision or to take (2) "DNA database" means the database that contains forensic DNA .~ec­ a personnel action relating to the person who .iS the subject of the information. ords maintained by the director. (3) "DNA laboratory" means a laboratory that performs forensic DNA (e) A state agency may not obtain criminal history record information under analysis on samples or specimenS- derived fro1n a human body or crime this section unless the state agency first adopts polici~s arid procedures that scene. provide that evidence of a criminal conviction or other relevant information obtained from the criminal history record information-does not automatically (4) "DNA record" means the results of a forensic DNA analysis performed . disqualify an .individual from employment. The attorney general shall review by a DNA laboratory and; if known, the name of the person who is the subject the_ policies and procedures for compliance with due grocess and other legal of the analysis. · req~irements before adoption by the state agency. The attorney _general may (5) "FBI" m~::ans the Federal Bureau of Investigation. charge the state agency a fee to cover the cost of the review. The policies and (6) "Institution of higher education" has the meaning assigned by Section procedures adopted under this subsection must providei that-the hiring official 61.003, Education Code. · will determine, on a case-by-case basis, whether the in~ividval is qualified for (7) "Institutional division" means the institutional division of the Texas employment based on factors that include: . Department of Criminal Justice. (l) the specific duties ofthe position; (8) "Penal institution" has the meaning assigned by Section 1.07, Penal (2) the number of offenses committed by the individual; Code. ' "'" (3) the nature and seriousness of each offense; Added by Acts 1995, 74th Leg., ch. 595, § 1, eff. Sept. 1, 1995. (4) the length of time ben."veen the offense and the employment d~cision; (5) the efforts by the individual at rehabilitation; and Historical and Statutory Notes Section J{a) of Acts 1995, 74th Leg., ch. 595 chapter G, Chapter 411, Government Code, as (6) the accuracy of the information on the~ individ4al's employment appli- provides: · · · added by this Act, not later than January 1, cation. 'The director of the Department of Public 1996."' Safety shall adopt the rules required by Sub- (f)-A-criminal-history-record-irifotrna!ipri proviSion }n_:[email protected] is (~.o~e _specific:to-a:siaie ·.;_g-~~~._:jii~i~dm.g·_ Se~tJ.o!1~41 ~ iOS~ .yrellail~-<?v~_~:_,_this Research References ~ section to the-extent of any cohllict.. Encyclopedias tion-Placing Child on Probation for Con- TX Jur. 3d Criminal Law§ 4372, Registration duct Constituting Sexual Offense. Added by Acts 2003, 78th Leg., ch. 87, § 1, eff. Sept. 1, 2003. as Sex Offender; Ochiectomy. TX Jur. 3d Crimiiial Law Five XX B Ref., Treatises and Practice Aids Divisional References. Library ReferenceS Forms Dix and Da.;..son, 43A Tex. Prac. Series Criminal Law =1226{2). § 39.110, Submit a Doa Sample to Dps. Texas Jurisprudence Pleading & Practice Westlaw Topic No. 110. Forms 2d Ed§ 94:36.10, Order-Of Disposi- C.J .S. Criminal Law§ 1734. Research References § 411.142. DNA Database Encyclopedias (a) The director shall record DNA data and establish and maintain a compu- TX Jur. 3d Public Officers & Employees terized database that serves as· the central depository in the state for DNA § 165, Generally; Merit System. records. ,: · 152 153 ·t···, --I ·n ~7 §411.142 I .. . . . 'EXECtmVE BRANCH . "'l n~e 4 ~ ~- DEPARTMENT OF PUBUC SAFElY Ch. 411 .. . . § 411.143 la&~1~};~~~~~Wl~"!rffi~t6~l!~~~:J:t·itseJn · th~ department's. c~~e § 4i Ll43 .. Purposes (c) The director m~y receWe, analyze, store, and, destroy a record. blood (a) The principal purpose of the DNA database is to assist federal, state, or sample; or' o~er specimen for the purposes d~bed' bY ,Section 4Il.143~ local criminal justice or.. law enforcement agencies in the investigation or prosecution of sex-related offenses or other offenses in which biological evi- .th~~~~~[~*~.ifJ~t~~~~;i~l;~~~;~~~~hiri~;-~lld. ~torlng dence is recovered. (e) The director,. With advice from the Department of Information Resources, shall develop biennial plans to: (I) improve the rePQrting and accuracy of the j)NA d~tabase; arid (2) deveiop and maintain a monit~nng systefu''~P'able ofidentifying in~c- (c) Otherpurposes of the database include: curate or incomplete infOrmation. · . · _. • : ' . . ~1~~~ • , n J!~Ui15e~InaYJi.c;on'-'!!'.t< · n'recOii<J:;';lO~;!ILQ~g;q (A) establishing a population statistics database; ., (I) a person described by Section 411.148 or 4J 1.150; (B) assisting·in idt:ntification research and protocol development; and . (2) a biological specinieil of a deceased victim. of~ ~rime; (3) a biological specimen that is legally obtained in. the investigation of a (C) assisting ih database or DNA laboratory quality controL crime, regardless of origin; · · · • .. ~: <'"'· (d) The inf()rmation contained in the DNA database may not be collected, . ·..· .;,:: . (@~testing ordered under Article 64:03, Cod; of Criminal Proce- ~: analyzed, or. stored to obtain information about human physical traits or . dure· . · ·. · • predisposition for disease unless the purpose for obtaining the information is .·tfS,~Utifi~~iitii)e~or¥u~~$~~~ta1Pfrema~;§? related to a purpose described by this section. . ~ ~~~; ' .· . elf~ · (e) The director may not store a name or other personal identifying informa- (6) a close biological relative of a person who has;J:,een reported missing to tion in the CODIS database. A file or reference number to another information a law enforcement agency; system may be included in the CODIS database only if the director determines (7) a persori at risk of becoming lost, such as a child or a person declared the information is necessary to: by a court to be mentally incapaCitated, if the recOrd is required by court (I) generate an ilivestigative lead or exclusion; order or a parent, conservator, or guardian of the,, person consents to the (2) support the statistical interpretation of a test result; or record: or (8) an unidentified person, if the record does not contain personal identify- (3) allow for the successful implementation of the DNA database. ing information. · (f) Except as provided by this subchapter. the DNA database mav nut incluJe (h)[The -deR'artmentsha:tr e~l51 isn StaJ]da.r.ds.for~DNA .·anal y~is th~;DN A ->b;. . criminal history record information. laboratory th.at.meet .or. exceed the current standards for· quality assttrance <,!n_d ......~ Added by i\cts 1995, 74th Leg., ch. 595, § I, t:ff. Sept. I, 1995. ,p}oficie~cy_ ~sti_Qg forJorensic;~Dl':JA ,analnLsjss·ued.-by.. the FBI-. -ThL.'oNA --~r/· ~~{~· data·b.;:.;e may contain only DNA records of DNA analyses performed according Libr"ry References to the standards adopted by the department. . · ·criminal Law ~1226(1). CJ.S. Criminal Law§ 1734. Added by Acts 1995, 74th Leg., ch. 595; § I, eff. Sept. I, 1995. Amended by Acts 100 I, Searches and Seizures €=>78. CJ.S. Searches and Seizures §§ J I. I 03 to 77th Leg., ch. 2. § 4[e!T.-Ajmr5;--200ll. West]aw Topic Nos. 110. 349. 106. ....._,._~ Library ReferencH Research References Criminal Law<!=> 1226( 1). ALR Library Westlaw Topic No. 110. 76 ALR 5th 239. Validity. Construction. and C.J.S. Criminal Law§ 1734. Operation of State Dna Database Statutes. 154 155 1 £!' I \ ~~ . §41l.143 EXECUTIVE BRANCH <DEPARTMENT OF PUBLIC SAFElY §411.145 Title 4 Ch. 411 Notes of Decisions (c) The director may at any reasonable time enter and inspect the premises In general I establish a population statistics database, assist or audit the procedures of any DNA laboratory that provides DNA records or Privacy rights 3 in identification research and protocol develop- Purpose 2 ment, and assist in database or DNA laboratory . _DNA forensic analyses to the department under this subchapter. quality control. In re D.L.C. (App. 2 Dist. 2003) (d) A DNA laboratory conducting a DNA analysis under this subchapter 2003 WL 22976095. Searches And Seizures e=> 't manitarian purposes, to assist in identification 22976095. Constitutional Law e=> 82(1 0); Con- of living or deceased missing persons, and to stitutional Law e=> 203; Infants e=> 132 Cross References Crime laboratory, accreditation process, see V.T.C.A., Government Code,§ 411.0205. § 41l.144. Regulation of DNA Laboratories; Pena,lties Regulation of DNA testing, see V.T.C.A., Government Code § 411.0206. (a) The director by rule shall establish PI:Ocedures for a DNA laboratory or Administrative Code References criminal justice or law enforcement agency in the· collection, preservation, DNA database, . see 37 .TAC § 28.1 et seq. shipment, analysis, and use of a blood sample or other specimen for forensic DNA analysis in a manner that permits the exchange of DNA evidence between Library References DNA laboratories and the use of the evidence in a criminal case. Criminal Law e=>I226(1). C.J.S. Criminal Law§ 1734. (b) A DNA laboratory or criminal justice or law enforcement agency shall Searches and Seizures e=>78. C.J.S. Searches and Seizures §§ 31, 103 to Westlaw Topic Nos. 110, 349. 106. follow the procedures: ( 1) established by the director under this section; and Fees (2) specified by the FBI, including use of comparable test procedures, laboratory equipment, supplies, and computer software. (a) The director may collect a reasonable fee under this subchapter: 156 157 ...._ § 411.145 EXECUTIVE BRANCH DEPARTMENT OF PUBLIC SAFElY Title 4 Ch. 411 § 411.147 (1) for the DNA analysis of a blood sample or other specimen submitted (0 If possible, a second DNA specimen must be obtained from a suspect in a voluntarily to the department; or criminal investigation if forensic DNA evidence is necessary for use as substan- (2) for providing population statistics data or other appropriate research tive evidence in the prosecution of a case. data. Added by Acts 1995, 74th Leg., ch. 595, § 1, eff. Sept. 1, 1995 .. (b) A fee collected under this section shall be deposited in the state treasury to the credit of the state highway fund, and money deposited under this section Library References and under Article 102.020(h), Code of Criminal Procedure, may be used only to Searches and Seizures ~78. C.J.S. Searches and Seizures §§ 31, I 03 to defray the cost of administering this subchapter. Westlaw Topic No. 349. 106. Added by Acts 1995, 74th Leg., ch. 595, § I, eff. Sept. I, 1995. Amended by Acts 200 I. 77th Leg., ch. 1490, § I, eff. Sept. I, 2001. § 411.147. Access to DNA Database Information Library References (a) The director by rule shall establish procedures: Criminal Law ~1226(1). (I) to prevent unauthorized access to the DNA database; and Westlaw Topic No. 110. C.J.S. Criminal Law§ 1734. (2) to release DNA records, specimens, or analyses froin ·the DNA data- base. (b) The director may adopt rules relating to the internal disclosure, access, or § 411.146. Blood Samples or Other Specimens '\ use of a sample, specimen, or DNA record in the department or it DNA (a) The director may not accept a blood sample or. other specimen taken laboratory. from a person who is not deceased that is submitted voluntarily or as required · (c) The department nay release a DNA sample, analysis, or record only: by Section 411.148 or 411.150 unless the sample or specimen is collected in a (1) to a criminal .iustice agency for law enforcement identification pur- medically approved manner by: ' poses; (1) a physician, registered nurse, licensed vocctionai nurse, licensed clini- (2) for a judicial p<oceedi.ng, if otherwise admissible under law; cal laboratory technologist; or (3) for criminal defense purposes to a defendant, if related to the case in (2) another person who is trained to properly collect blood samples or which the defendant is charged; or other specimens and supervised by a licensed phy~;ician. ·(4) if personally identifiable information is removed, for: (b) A person collecting a blood sample or other specimen under this section (A) a population statistics database; may not be held liable in any civil or criminal action if the person collects the (B) identification research and protocol development; or sample or specimen in a reasonable manner according to generally accepted (C) qilality control. medical or other professional practices. (d) The director may release a record of the number of requests made for a (c) The director shall provide at no cost to a person described by Subsection defendant's DNA record and the name of the requesting person. (a) the specimen vials. mailing tubes and labels. report forms. and instructions for collection of blood samples or other specimens under this section. (e) A law enforcement agency may have access to DNA specimens through the agency's laboratory for law enforcement purposes. (d) A person who collects a blood sample or other specimen under this section shall send the sample or specimen to: (0 The director shall maintain a record of requests made under this section. (I) the director at the department's crime laboratory; or Added by Acts 1995, 74th Leg., ch. 595, § 1, eff. Sept. 1, 1995. (2) another location as required by the director by rule. Cross References (e) A DNA laboratory may analyze a blood sample collected under this Crime laboratory, accreditaticn process, see V.T.C.A., Government Code, § 411.0205. Regulation of DNA testing, see V.T.C.A., Government Code § 411.0206. section or other DNA specimen only: (1) to type the genetic markers contained in the sample or specimen; Library References (2) for criminal justice and law enforcement purposes; or Criminal Law ~1226(1). Westlaw Topic No. 110. (3) for other purposes described by this subchapter. C.J.S. Criminal Law§ 1734. 158 159 --~- ·--r-- § 411.1471 EXECUTIVE BRANCH DEPARTMENT OF PUBLIC SAFETY § 411.1472 Title 4 Ch. 411 § .411.14 71. DNA Records of Persons Charged With or Convicted of Cer- .(e) Notwithstanding· Subsection (d), on acquittal of a defendant described by tain Felonies Subsection (a)(l) or (2) or dismissal of the case against the defendant, the court shall order the law enforcement agency taking the specimen to immediately (a) This section applies to a defendant who is: destroy the record of the collection of the specim~n and require the department ( 1) indicted or waives indictment for a felony prohibited or punishable to destroy the specimen and the record of its receipt. · under any of the following Penal Code sections: (0 A defendant who provides a specimen under this section is not required to (A) Section 20.04(a)(4); r provide a specimen under Section 411.1472 or provide a sample or specimen (B) Section 21.11; under Section 41 L 148 or 411.150 unless an attorney representing the state in (C) Section 22.011; the prosecution of felony offenses establishes to the satisfaction of the director that the interests of justice or public safety require that the defendant provide (D) Section 22.021; additional samples or specimens. (E) Section 25.02; Added by Acts 200 I, 77th Leg., ch. 1490, § 2, eff. Sept. I, 200 I. (F) Section 30.02(d); (G) Section 43.05; Historical and Statutory Notes (H) Section 43.25; or Section 8 of Acts 2001, 77th Leg., ch. 1490 under Sections 411.1471 and 411.1472, Govern- provides: ment Code, as added by this Act." (I) Section 43.26; "The director of the Department of Public Safety of the State of Texas, not later than Section 9 of Acts 200 I, 77th Leg., ch. 1490 (2) arrested for a felony described by Subdivision (1) after having been January I, 2002, shall adopt rules relating to provides that tliis section applies to a defendant 'previously convicted of or placed on deferred adjudication for an offense duties i!fiposed on law enfo-rcement agencies arrested on or after February I, 2002. described by Subdivision. (I) or an offense punishable under Section 30.02(c)(2)~ Penal Code; or Library References (3) convicted of an offense under Section 21.07 or 21.0'8, Penal Code. Criminal Law= 1226(1 ). C.J.S. Criminal Law§ 1734. Searches and Seizures <!::>78. C.J.S. Searches and Seizures §§ 31, 103 to (b) After a defendant described by Subsection (a)(l) is indicted or waives Westlaw Topic Nos. 110, 349. 106. indictment, the court in which the case is pending shall require the defendant ... to provide to a law enforcement agency one or more specimens for the purpose § 411.1472. DNA Records of Persons Placed on Community Supervision of creating a DNA record. A law enforcement agency arresting a defendan-t for Certain Offenses · described by Subsection (a)(2). immediately after fingerprinting the defendant and at the same location as the fingerprinting occurs, shall reQuire the defen- (a) This section applies to a defendant placed on community supervision, dant to provide one or more specimens for the purpose of creating a DNA including deferred adjudication community supervision, for an offense listed in record. After a defendant described by Subsection (a)(3) is convicted or placed Section 411.1471 (a)(l). on deferred adjudication, the court shall require the defendant to provide to a law enforcement agency one or more specimens-for the purpose of creating a (b) A court that grants deferred adjudication or places a defendant on DNA record. · community supervision shall at the time of entering the order or making the placement require the defendant to report to a law enforcement agency to (c) A defendant described by Subsection (a)(l) or (3) may at any time provide one or more specimens for the purpose of creating a DNA record. voluntarily provide a specimen for the purposes described by Subsection (b). (c) The director by rule shall require law enforcement agencies taking a (d) The director by rule. shall require law enforcement agencies taking a specimen under this section to preserve the specimen and maintain a record of specimen under this section to preserve the specimen and maintain a record of the collection of the specimen. A law enforcement agency taking a specimen the collection of the specimen. A law enforcement agency taking a specime~ under this section may use any method to take the specimen approved by the under this section may use any method to take the specimen approved by the director in the rule adopted under this subsection. The rule adopted by the director in the rule adopted under this subsection. The rule adopted by the director must prohibit a law enforcement agency from taking a blood sample director must prohibit a law enforcement agency from taking a blood sample for the purpose of creating a DNA record under this section. The agency may for the purpose of creating a DNA record under this section. The·agency may either send the specimen to the director or send to the director an analysis of either send the specimen to the director or send to the director an analysis of the sample performed at a laboratory chosen by the agency and approved by the sample performed at a laboratory chosen by the agency and approved by the director. the director. 160 161 -1'\- TEXAS DEPARTMENT OF PUBUC SAFETY PHYSICAL EVIDENCE SUBMISSION FORM PLEASE PRINT OR WRITE LEGIBLY SEE INSTRUCTIONS ON THE BACK OF THIS FORM IDS DP$ UBORATDI'lY USE ONL.Y .; I ~= ~ Lltentr. AFIS .... I Submllllon Oa!tJ 71612001 Flra!:nnl Alcahal PhaCo Oulllt. Doc. TOII!cdagy l3M 48628 / . lnveltiglerr (Title. N.amt) JOEL CASTRO CSS !J/ Send Cclpy to JOEL CAS"m01 CSS ~ HIDALGO COUNTY SHE~FF"S DEPART A~ HIDAlGO COUNTY SHERIFF'S DEPART Addresa P. 0. BOX359 Addrela P. 0. BOX 359 C1tV. Stl:le EDINBURG 1 TEXAS Z1p 78540 . Clly,Stllle EDINBURG 1 TEXAS Zip 78540 Phone Number 956-383-811<4 Submltllng AtJent:t F1e Number F.,ctunber SUSPECTS a..t. Flrlf 95&-383--1187 Middle\ Race Se DOB I VICTIMS ~last. Fnt Mlddlel 01·13017 RaCe Sex I MIRELES GUSTAVO w M ROBOUAR ~JANE w F 6J1! 3 REMOVED FROM RIGKT SOCK OF VICTlM AT SCENE . HIAR STRANDS REMO\IED FROM BODY OF VJCT1M AT SCENE 5 BLOOD STAIN UFT I BLOOD STAIN UFT OUTSIDE PASSENGER DOOR CHEVY P/U TO ITEMS I %2,36 KANSAS LP UCE 432 13 STAINS, HAIRS. COMPARE TO t .zue FROM BODY OF VICTIM AT AUTOPSY STAINS, HAIRS. COMPARE TO '" t%2.38 STAINS, HAIRS. COMPARE TO 15 '22.38 te REI.40VED FROM BODY OF VICTIM AT AUTOPSY STAINS. HAIRS. COMPARE TO WARE" t%2.30 . . - I . J &.' : ~. ' ~ . t f.L / ~0- . TEXAS DEPARTMENT OF PUBUC SAFETY PHYSICAL EVIDENCE SUBMISSION FORM PLEASE PRINT OR WRrrE LEGIBLY SEE INSTRliCnONS ON THE BACK OF THIS FORM DPS UBORA TORY liSE ONLY ~·- ~ -; SubmiuJcn 0«1 71612001 I / Tra::e Drugs Flrl8rma AJcd'rd E:l l3M 4 8 6 2'8 I ~IU:JI (Tlk.Narne) JOEL CASTRO CSS iii HIDALGO COUNTY SHERIFF'S DEPART S...SC!lpyto JOa CASlR0 1 CSS HIDALGO COUNTY SHERIFF'S DEPART Arlrcr AIJ«r:y ~ P. 0. BOX 359 A.cilfn!ll P.O. BOX359 City, Stille EOINBURT, TEXAS . Zip 78540 Clly, SUI!C EDINBURG 1 TEXAS Zip 78540 Phc:nl Number 956-383-811"' Submitting AQt«:J File Number F• NIA'Tibar 958-383-4187 SUSPECTS lUst. F"nt Middle) Raoe Sa 008 I VICTIMS ll..ad. Flrllt ~ 01-13077 Race Sill _DC) RELES GUSTAVO w M ROBOUAR MARY JANE w F 811911 -----=CAP~rr.~AL~O&nM~M~UR~O~E=R~----~~ ~~-----------~~~~~~~~1----------~~~~---------~-H~I=O~~~~~O~-·----­ ITEIIS OF 'HYBJC4 EVIDENCE IUBMTTED Ean Requested ":!...~ ..Ahlbll No. Origin !A., ~.eli;.) (loa-. ............ . , ............, tc-.!DA..-:.) 23 HAIR STRANDS . INSIDE BLACK PURSE COMPARE TO rrEMS t 23.36 24 BLACK twroi.E SHORT PHIWPS SEAT GMC PAJ TRUCK TX LP .ltV 7110 TRACES OF BLOOD, SKIN 'nSSUE. HAIR. HEAD Sau:w DRIVER COMPARE TO ITEMS t 23.36 25 a.EAR AND RED Hot.NCC..E LONG Dof.SHSOAAD GMC PIU TRUCK TX LP J1V 790 TRACES OF BLOOD, SKIN nS$UE. HAIR FLATHEAD SCREW DRIVER COMPARE TO ITEMS t 23.36 · 2e BLACK HANDLE STEAl< KNIFE FLOORBCWW GMC PIU TRIJCK TX LP JW 710 TRACES OF BLOOD, SKIN 'nSSUE, HAIR. -nv.MOHnNA• COMPARE TO rtEMS I 23.38 21 HAIR STRANDS FlOORBCWW GMC PAJ TRUCK TX.LP J1V 790 COMPARE TO ITEMS t 23,36 28 HAIR STRANDS SEAT GMC PAJ TRUCK TX LP J1V 780 COMPARE TO JTEMS t 23,3& . 28 BLUE IN COLOR SEAT COVER SEAT GMC PIU TRIX:K TX LP JW 780 COMPARE TO ITEMS t 23.3& 30 PR SPRAY PAJNTED BLACK MILITARY HUECES COUNTY DETC~ CENTER TRACES OF BLOOD. SKIN TISS\JE. t-WR. TYPE BOOTS SIZE 1 t I 55070 INJMTE GUSTAVO MIR£LES PROPERTY COMPARE TO ITEMS t 23.38 31 GRAY PUU.-OVER POLO TYPE T· NUECES COUNTY DETENTION CENTER TRACES OF BLOOD, SKIN TISSUE, t-WR. SHIRT epREMIRf8 SIZE L INMATE GUSTAVO MIRELES PROPERTY COM'ARE TO ITEMS I Z3,3e page2 ct3 RECEIVED '. rr rr o_t\ 1nnt _..,..,. PiNse Include I brief aynapsll Cl' capy ~ the cft8lae repat to asaist the Wlll)ost · Submit ., ~ a'ld two c:cpie5 (If I 5Umped ret:a9lll nquiled). LABORATORIES MCALLEN -Mi- TEXAs DEPARTMENT OF PUBUC SAfETY PHYSICAL EVIDENCE SUBMISSION FORM s s .. ~NA PLEASE PRINT OR WRITE LEGIBLY ~ SE£ INSTRIJCT10HS ON TlfE BACK OF THIS FORM .'JPISLASORATORYUSEOIIl.'l ~~___s~-~~~~~:~~~~~~~8~~--d·__8___~_··-~_·__l_3_M_·__4_8_·_6_2__8______ I' ~ (Title.Narne) JOEL CASTRO CSS ~ Send~ to JOEL CASlRO, CSS Atptcf HIDALGO COUNlY SHflJRFF'S DEPART ~ HIDALGO COUNlY SHERIFF'S DEPART AddresG P. 0. BOX 359 ~ P. 0. BOX 359 City, SUllO EDINBURG, TEXAS ZJp 78540 City. Slllto EDINBURG, TEXAS Zip 78540 956-lln-811<4 956-383-<4187 01-13017 ....;S::.:U;:.SP:..:E::::CTS:.:.:.;tl~.::l.Mt.:::::...:..:fni==..::::::Mdd=le:.~..-1_ _ _ _-f.:.Race=~Se:r=-f..--=DO=B___. VICTI'MS n.-. Fln:l Mddlel Alee Sex DOE ~M~IR~E::.:LE~S~G~U~S~TA~~~--------------~W~~M~----~ ROBO~MARY~E W F 6/19r'11 ------~~~~~~MU~R:D~E~R ____ ~I ~~----------DH~~~~~~~oo~1----------~~ ~~--------~~H~ID=~~~~------- ITbiS OF PHYSICAL EVIDENCE IU8MITTED ~No. n.n .ia;c.Delcrlptlan _ _, Ortgln E.ln Requetecl c-..,._ ..., ""'' .S.*-J rs.--...,_IH _..,...·*-' 32 BWE DENIM JEANS "'PEN THAD" NUECES COUNTY DETEHTION CENTER TRACES OF BlOOD, SKIN 11SSUE, HAIR. WISTAINS SIZE 38X32 INIMTE GUSTAVO MIRElES PROPERTY COMPNUJ;. TO ITEJoiS II 23.311 34 WHilE IN COLOR FTl UNDERWEAR NUECES COIJN1Y DETENTION CENTER TRACES OF BLOOD, SKIN TISSUE, HAIR. INMATE GUSTAVO MIRELES PROPERTY COMPARE TO rTiMS II %3.36 35 HAIRSTRAHO RIGHT PANTS LEG OF BLUE DEHtM JEANS COMPNUJ;. TO rTEMS II 23.31 ~·32 42A ORANGE HANDLE SCREWDRIVER, SIE BEDROOM INSIDE lV CONSOLE FM 43 & TRACES OF BLOOD. St<JN TISSUE. IWft. 428 RUSTED DRILL BIT m. CORPUS CHRJST1 COMPARE TO ITEMS II 23.36 48 SERATED KITCHEN KNIFE WITH TOP BEDROOM NIE CORNER OF RESIDENCE TRACES OF BLOOD, S1<IN nSSUE. HAIR. BLACK HANOt.E E OF TOWER ON ELGATO, AJ:.N/0 COMPARE TO ITB.CS II 23,35 22 SEXUAL ASSAULT EVIDENCE REMOVED FROM BODY OF VICTIM AT AUTOPSY SEMINAL STAINS. FOREIGN HAIR. TISSUE. COUEcnONKIT COMPARE TO ALL SUBIIIlTED ITEMS 36 SUSPECT EVIDENCE COLLEcnON REMOVED FROM BODY OF SUSPECT AT COMPARE TO AU SUBMTTED ITEMS KIT NVECES COUHTY DETEHnON CENTEA RECEIVED page3d3 JUL 0 5 2001 L.AtsORATORIES MCALLEN P~ lndude 1 brief sync:p~a a CDPY r:llhe ol'alM repcrt to ll!oSisl!hi~Wl~WySi. Submll an arlginall " two c;gpies (If I stamped ra:zipl il A!QUirld) . . ("'\ Lt rl V'1.u..l 1. . . -( \r·· t1.'1.J' . . ( l l • ) • "\ t 1~ J. ( (t •7 c-. ~ TEXAS DEPARTMENT OF PUBLIC SAFETY '-/ _;::;} TEXAS OPS FIELD CRIME LAB ORA TORY / . 1v-0 t;,Y P.O.BOX819 MCALLEN, TEXAS 78505-0819 \"- \ fj ~ • -.. Voice 956-984·5600 Fax 956-984-5713 V . •Jt . ---------- .......-\. \~~- -~ v-.1'-~ "...; ...... I V\. I _ • I COMioiiSSION THOiolA.S A. DAVIS, JR. · Dece mber 12 , 2001 ""v. c}. "T'Q l 0) \ v, c+ · cou.u~o~ Mc.KuG~ ('A. ~ • DIRECTOR FRANKIE WAU.ER c:HAJRioWI DAVI~r.t.:E.ATHROH ROBERT 8. HOLT A.SST. DIReCTORS JAMES 8. FRAHCIS •• COMMISSIONERS Joel Castro .: ! Hidaigo County Sheriffs Office Box 3.59 Edinburg, Texas 78540-0359 Agency Case Number Offense Date Laboratory Case Number 0113077 06/23/01 L3M- 48628 Suspect{s) Victim(s) Mireles, Gustavo Robollar, M~ry Jane 0?-19-60 I Offense: Homicide County of Offense: Hidalgo (108) Evidence s·ubmitted .. Refer to results of analysis. / )quested Analysis . . . . . . . · ·· . . . Determine the presence of semen, blood foreign hair and any sign.lficarif trice evide'rice. ·compare I using DNA analysis~ ResultS of Analysis On July 6, 2001, in person by Joel Castro: ITEM DESCRIPTION ORIGIN RESULTS 2 Hair strands Victim's right buttock - No DNA was recovered from three hairs tested. Apparent burned tissue wa$ observed. 3 Hair strands Victim's right sock Three hairs were observed. Two hairs were f\l l +(, ~ k_ "'~ c~ fl\A,'f. J, Q')\ Vt:c.,.!~vvisually similar to the victim's pubic hair ,f ~ M ~ eM standard. The hairs were not collected. The .h ~d. Y .~ ~ ."' ...-~_. ;- .;..1 third hair was recovered for DNA analysis. ) f"'.l- > vJ...d ~ (.A ' ~t·vnvv · ....... The victim cannot be excluded as the ..J.k ~a -vA. ""r .J ~ > ""'~<.contributor of the DNA.· See DNA results. The ·~ J , ~ ~"'"" f ·N s~ .(:: ~- wtJf suspe~ is excluded as the contributor. - - Hair strand Victim's lbody"' t · Visually similar to victim's head hair standard. Apparent tissue tested positive for apparent / : .. -- :· --~. . blood. No further analysis was done. ... ···-- ....... ---· - ___ . ..:..------ ., 5 Bloodstain lift Outside passenger The appar(mt bloodstain'was determined to be door of Chevy P/U of human origin. The DNA profile is consistent Kansas L. P. LXE 432 with the suspect. See DNA results. ······'). 6 Bloodstain lift Outside passenger The apparent bloodstain was determined to be door of Chevy P/U of human origin. The DNA profile is consistent Kansas L. P. LXE 432 with the suspect. See DNA results. COURTESY- SERVICE • PROTECTION / Offense Date Agency Case Number · Laboratory Case Number 06/23/01 0113077 L3M- 48628 ' RESULTS ·)rEM DESCRIPTION ORIGIN 13 Pullover top Victim No acid phosphatase, a non-speciflc fJ o ~ ( J J ..v ,·'VIe.. ck- k c...~ VV'. constituent of semen, was detected on the l:l, .>4 "00 f-"f' 0 'io ~ ~ J.. .11. (J apparent bloody pullover top. A tape-lift of the r ,. 1 "" . r\~ 1· '( ~ sfi1rt was done and returned with the Item. If CJ·<'\ .J e W1 ,. • ' •~ "' \\ P I S 1fiber analysis is needed contact this laboratory. An ap.e_arent bloodstain was determined to be 14 Jeans Victim offliJman origin. The DN~e is consistej with the~ct. see DNA results. No acid j5fi'Osj5flat8se. was detected on the jeans. Apparent fecal matter was observed. Victim ~ D_l!~s re.~Q.y~!!:2L"-~- ~S.-~il.t_ 15 I .. ... ~ .J I! ~ t'"· ' ..-~ -(.. _jiiQ.Qdstaio· No acfd phosphatase was detected. Head hair visually similar to the victim's head hair standard was observed. No acid phosphatase was detected. Apparer 16 ·Panty Victim fecal matter was observed . ---··--·"' . ..... Hair strands ··-- ... ·-- .. -· -----------..., Black purse th~;:s;,ect's ,......-Three hairs visually similar to 23 pubic hair standard were recovered. Two of the thr~e hairs were DNA tested (Hairs 1 and 2). The third hair was collected but not testae ) (Hair 3). One hair whose origin could not be detennined was DNA tested (Hair 4). Two hair fragments visually similar to victim's hea· hair standard were observed and not collected.· ... The .DNA profiles from Hairs 1 and 4 are consistent with the su·spect. See DNA result "'\,_~-~N~-~~s r e c o v e r e d - No blood was detected. No significant trace 24 Phillips screwdriver Seat GMC PIU evidence was observed. · TX LP. JIV 790 No blood was detected. No significant trace Flat head Dashboard GMC P/U 25 TX LP. JIV 790 evidenc~ was observed. screwdriver No blood was detected. No significant trace Steak knife Aoorboard GMC P!U 26 evidence was observed. TX L P. JIV 790 Four hairs visually similar to the suspect's Hair strands Floorboard GMC P/U 27 head hair standard were observed. One hai TX L P. JIV 790 was collected. If further analysis is needed contact tl:lis laboratory. Six hairs visually dissimilar to the vlctim and suspect's head E pubic hair standards were observed and no collected. Apparent animal hairs were observed and not collected. Plant-like J substance was observed and not collected. P~n= 2,.r.f 5 12/12/01 Offense Date Agency Case Number · Laboratory Case Number 06/23/01 0113077 L3M- 48628 ' RESULTS ·)rEM DESCRIPTION ORIGIN 13 Pullover top Victim No acid phosphatase, a non-speciflc fJ o ~ ( J J ..v ,·'VIe.. ck- k c...~ VV'. constituent of semen, was detected on the l:l, .>4 "00 f-"f' 0 'io ~ ~ J.. .11. (J apparent bloody pullover top. A tape-lift of the r ,. 1 "" . r\~ 1· '( ~ sfi1rt was done and returned with the Item. If CJ·<'\ .J e W1 ,. • ' •~ "' \\ P I S 1fiber analysis is needed contact this laboratory. An ap.e_arent bloodstain was determined to be 14 Jeans Victim offliJman origin. The DN~e is consistej with the~ct. see DNA results. No acid j5fi'Osj5flat8se. was detected on the jeans. Apparent fecal matter was observed. Victim ~ D_l!~s re.~Q.y~!!:2L"-~- ~S.-~il.t_ 15 I .. ... ~ .J I! ~ t'"· ' ..-~ -(.. _jiiQ.Qdstaio· No acfd phosphatase was detected. Head hair visually similar to the victim's head hair standard was observed. No acid phosphatase was detected. Apparer 16 ·Panty Victim fecal matter was observed . ---··--·"' . ..... Hair strands ··-- ... ·-- .. -· -----------..., Black purse th~;:s;,ect's ,......-Three hairs visually similar to 23 pubic hair standard were recovered. Two of the thr~e hairs were DNA tested (Hairs 1 and 2). The third hair was collected but not testae ) (Hair 3). One hair whose origin could not be detennined was DNA tested (Hair 4). Two hair fragments visually similar to victim's hea· hair standard were observed and not collected.· ... The .DNA profiles from Hairs 1 and 4 are consistent with the su·spect. See DNA result "'\,_~-~N~-~~s r e c o v e r e d - No blood was detected. No significant trace 24 Phillips screwdriver Seat GMC PIU evidence was observed. · TX LP. JIV 790 No blood was detected. No significant trace Flat head Dashboard GMC P/U 25 TX LP. JIV 790 evidenc~ was observed. screwdriver No blood was detected. No significant trace Steak knife Aoorboard GMC P!U 26 evidence was observed. TX L P. JIV 790 Four hairs visually similar to the suspect's Hair strands Floorboard GMC P/U 27 head hair standard were observed. One hai TX L P. JIV 790 was collected. If further analysis is needed contact tl:lis laboratory. Six hairs visually dissimilar to the vlctim and suspect's head E pubic hair standards were observed and no collected. Apparent animal hairs were observed and not collected. Plant-like J substance was observed and not collected. P~n= 2,.r.f 5 12/12/01 • Laboratory C~se Number /\gene~' Cn~c Number Ottense Date . L3M- 48628 0113077 06/23/01 ) ITEM DESCRIPTION ORIGIN RESULTS 228 Two vaginal swabs Victim No semen was detected on the apparent bloody vaginal swab. 22C .. Vaginal smear Victim No spermatozoa, a semen-specific . constituent, were observed . 220 Two rectal swabs Victim No semen was detected. 22E Rectal smear Victim No spermatozoa were observed. 22F Two oral swabs Victim No semen was detected on the apparent bloody oral swabs . . 22G Oral smear Victim No spermatozoa were observed on the apparent bloody oral smear. 22H Head hair Victim Used as standard. 221 Head hair combing , Victim No apparent foreign hair was recovered. . 22J Pubic hair Victim Used as standard. 22K' Pubic hair combing Victim ,No apparent foreign hair was recovered. Red apparent fibers were observed. 22L Fingernail scrapings Victim Apparent blood was detected and was t' '). determined to be of human origin. The victim cannot be excluded as the· DNA contributor. See DNA results.. The sus~ect Is excluded as the contrl r. Halrs_y)_sua ly similar to the 'VJc m's head hair standard were observea anc . norCollecie;;C-·:-··-· --·- ........ ~ ...... . 36 Evidence collection Suspect kit 36A Purple top blood Suspect Used as known standard. tube 368 Yellow top blood Suspect No analysis done. tube I 36C Head hairs Suspect Used as standard. 360 Pubic hairs Suspect Used as standard.· DNA Results: Three hairs from the victim's right buttock (#2); one hair from the victim's right sock (#3); two bloodstains outside passenger door of Chevy P/U, Kansas L P. LXE 432 (#5), (#6); a bloodstain from the victim's jean (#14); stain from the victim's bra (#15); blood from the victim's fingernail scrapings (#22L); three hairs from the black purse (#23); one hair from the floorboard GMC P/U TX L P. JIV 790 (#28); three bloodstains fro the seat cover GMC PIU TX LP. JIV (#29); hair from the jeans (#35); seat cover GMC P/U, TX L P. JIV . 790; suspect's pullover shirt (#31), jeans (#32); stains from suspect's boots {#30A), (#306); victim's blood . )#22A), and suspect's blood (#36A) were subjected to STR PCR DNA analysis and the following loci were characterized: D3S1358, WVA, FGA. Amelogenin,.08S1179, D21S11, 018S51, 055818,0135317 and 075820. • . ' " ' - - - A -Z f: 1 ?/1 ?ln1 Laboratory Ca~e Number Agency Case Number Offense Date • L3M· 48628 I o t 0113077 06/23/01 , )he DNA profiles from the two bloodstains outside the door of Chevy P/U (#S':and #6), bloodstain from the victim's jeans {#14) and one hair from the black purse (#23 hair 1), are consistent with the suspect, Gustavo Mireles. Gustavo Mireles cannot be excluded as the contributor. The probabllity of selecting an unrelated person at random who could be the source of this DNA profile is approximately 1 In 1,168, 000,000,000 for Caucasians, 1 in 301,700,000,000,000 for Blacks and 1 in) 47,300,000,000 for Hispanics. The appr~ximate world population is 6,000,000,000. - The DNA profile from a second hair from the black purse (item #23 hair 4) is consistent with the DNA profile of the suspect, Gustavo Mireles. Gustavo Mireles cannot-be excluded as the contributor at the loci Amelogenin, 0851179, D21 S11, and D7S820. At these loci the probability of selecting an \.mrelated person at random who co~ld be the source of this DNA profile is approximately 1 -In 34,230 for Caucasians, 1 in e 1 1,900 for Blacks and 1 in 24,180 for Hispanics. The approximate world population is 6,000,000,000. The DNA profiles obtained from the hair from the victim's sock {113) and blood from the victim's fingernail scrapings (#22L) are consistent with the DNA profile of the victim, Mary Jane Robollar. Mary Jane Robollar cannot be excluded as the contributor at the loci Amelogenin and 0851179. At these loci the probability of selecting an unrelated person at random who could be the source of thls DNA profile is approximately 1 in 28 for Caucasians, 1 in 9 for Blacks and 1 in 14 for Hispanics. The approximate world population Is . 6,000,000,000. The suspect is excluded as the contributor of the hair from the victim's sock and blood from the victim's fingernail scrapings. · _ ·No bNA profile foreign to the suspect was obtained from the suspect's shirt (#31) or jeans {#.32). No DNA profile was obtained from Items 112, #15, #23 hair 2, #28, #29, 1130A, #308 or-1135 . . . ) The evidence _is being retained. Please n:'ake arrangements to pick it up as soon as possible • .Ala. do~ .· ' . Orlando Ochoa Criminalist Texas DPS McAllen Laboratory ~ t ... 12/12/01 f ~UHT 4 ·- TV Harllngen, 1X: UOUOlea U~A l=.ao UlWa llnpaci .i ~ & "'6"' ........... --s--o { testing. What's to say that wasn't affected?•] OPS meantime, maintains that they did not try to conceal the lab dosure. They have reviewed 40 cases so far, and have found no evidence of faulty testing. They must still scrutinize about 187 more. Alex Madrigal, the lab chief prlmartly r:esponslble for DNA testing has since been suspended with pay. t.'WollLDNow All content C Copyrtght 2000 • 2004 WortdNow and KGBT. All Rights Reserved. For more Information on this lite, plene read our Prtvacy f?o!lcy and Tenns or Service. • http://www.team4news.com/globallstory.up?s-1716313&CllentType-Printable 3/17/04 Review: 40 crime lab cases accurate Page 1 oR I Publication: Freedom- The Monitor; Date: Mar 17, 2004; Section: Front Page; Page:-1 ~'l''*, Review: 40 crime lab cases accurate By SARAH OVASKA and RYAN GABRIELSON Monitor Staff Writers [email protected] rgabrielson@themonltor .com .. McALLEN a€" A McAllen-based DNA crime lab found no problems in a re-examination of 40 cases despite inconsistencies in maintaining police evidence that caused the laba€™s closure for three months last summer. The Texas Department of Public Safety Criminal Laboratory, I . located in McAllen, reviewed 40 DNA samples and found no erroneous results or mistakes. However, a much larger review is currently under way, with 187 DNA samples scheduled for re- examination and retesting, according to a DPS representative. The lab analyzes DNA evidence, found in blood, saliva and -~, semen, for a number of police agencies in the area. The McAllen crime lab was shut down from June 16 to Sept. 23, 2003, with no notice given to local prosecutors, police agencies c defense attorneys. The evidence submitted during that time was disp·ersed throughout the agenciesa€™ other crime labs. After staff was retrained this summer, the lab is back up and running, · according to a press release from DPS. "We dona€™t know exactly what the issue was with the lab," said Victor Rodriguez, the McAllen police chief. "Wea€™ve not seen any unusual changes in the response time ... ' With response times up to six months for some tests, Rodrigue: said his officers and investigators continued to drop off evidence at the crime lab across the street from the police station, and were unaware that the laba€™s operations had been shut down "It (DNA) doesna€™t come up that often," said Jaime Aleman, criminal defense attorney with a number of capital murder cases "Ninety percent of the cases still go back to the old-fashioned evidence" like eyewitnesses or circumstantial evidence. Aleman said the problems at the DNA lab may highlight for the public what those who work with criminal defendants already know. "The default mode is to believe a police officer," Aleman said. i I "We in our profession know that mistakes are made." i l 1 ., Meanwhile, other defense attorneys said they doubted any cas .{ I 1 would be thrown out based on' the DNA laba€™s problems. 1 J "In the 300 cases (being reevaluated), not all 300 were innoce l ! • ..... I • 'VT : 1- • T "" 1 () /? 11 Review: 40 crime lab cases accurate drop the charges against his client based on the questions surrounding the· DNA lab. Juan Tostado is accused of killing Lee Roy Rosales in 1993. Tostado, a convicted drug smuggler, was the last person seen with Rosales, according to Monitor archives Rosalesa€™ body was found in a San Juan canal. Hector Villarreal, an Edinburg attorney, was retained a week ago to defend Tostado, whose trial is scheduled for March 29. "Anything having to do with DPS and the Texas Rangers is suspect," Villarreal said. "We need a federal investigation of Dl and the Rangers." However, the DNA evidence in Tostadoa€™s case was analyze in 1997 by Dallas-based Gene-Screen DNA labs, said Sgt. IsraE Pacheco, the Texas Ranger who investigated the case. "He (Villarreal) needs to become more familiar with his clienta€™s case before he starts criticizing the evidence," Pachl said. j Pacheco added that the audit results on the DNA lab are not t big a deal. "Thata€™s the point of an audit, invariably youa€™re always going to find some shortcomings," Pacheco said. "When the du settles, the results are going to be the same." a€"a€"a€"Sarah Ovaska covers courts anq general assignmen for The Monitor. You can reach her at (956) 683-4445 . . a€"a€'~a€"RyanGabrielson covers Pharr, San Juan, Alamo anc general assignments for The Monitor. You can reach him at (9: 683-4462. . Four to be questioned about McAllen DNA lab Page 1 of 1 Publication: Freedom· The Monitor; Date: Apr 22, 2004; Section: Valley & State Continued; Page: 13 tP Adt..Paoe<· Four to be questioned about McAllen DNA lab By DANIEL PERRY Monitor Staff Writer [email protected] AUSTIN a€" Four subpoenaed Texas Department of Public Safety employees in McAllen must give depositions regarding the citya€™s troubled DNA criminal laboratory. The employees, whose names were unavailable late Wednesday afternoon, will appear at a future meeting of the House Committee on General Investigating in Austin. "There were some allegations made that the lab in the (Rio Grande) Valley in part was having problems, but that is all I can tell you right now," said Rep. Terry Keel, R-Austin, a committee member. The committee met Tuesday and heard from two DPS lab employees in a private session. ~,-, The laboratory was closed from June 16, 2003, to Sept. 23, 2003, but no law enforcement agencies, defense attorneys or prosecutors were notified., The closing stemmed from a departmental audit that found problems with how chemicals for DNA testing and sexual assault kits were handled. Forty cases were re-examined by DPS earlier this year and found not to have any problems. At least 150 cases were still being revisited, according to DPS information. a€"a€"a€"Daniel Perry covers McAllen, Hidalgo and general assignments for The Monitor. You can reach him at (956) 683-4454. i J. i I l 1i l i 1 on 1 no 1 1 HPD qlme lab Narda u, 2001, J2rS4PM DPS secretly shuttered DNA ~ab .• State rep troubled by lack of transpareney during review For more thin three months last year, the Texas Department t4 Public Sataty, wflldl oversees the ac:credltatlon daD public DNA labs In the state. Quietly shut down the DNA division of Its own regional crime lab In McAllen. Durin; that time, the DPS began a review of petflaps as many as 300 c:rlmlnal cases but diose not to nodly most of the prosecutors or poUc:e, and none of the defendants or defense attorneys, . Involved In those ca.s., the HoustDn OU'Dnlde has leamed• News of the state agenc.y's ongoing scMtny of Its own lab, and Its decision to keep QUiet about the probe, dlstU'rtled a state lawntalcer Who last year sponsored legiSiatSon regulating public DNA labotatortes. "'t maJces you wonder If' they are capable of running tt· and whether or not tfley're glvff19 us run lnfarmatton,• said Rep. ICaYin Belley, D-HoustDn. In ~ to the doalnt of DNA labs In Houston and fort Wortb within months of each other last year, Baney, the c:halnnen of the House Committee on General Investigating, sponsored a . law requlrlng that aD public DNA labs In the state be acaedlted by Septambel 2005. ·'The law also gives the DPS· responslbiUty for overseeing that PfOC8SL But now a frustrated Bailey wande.s If the agency Is UP to the taste. "We're going to have to take a hard took at DPS,• he said. "' don't ~cnow·lf they're not doing their job property or they're trying to tilde rnrormatton. It goes bade to the old Issue that people's liveS era at slake and no one seems to c:ant.• The McAllen DNA lab was~ dosed after an Internal performance audit exposed a number of problems. The lbJif was retniJned during the shutdown, but the had of the lab has been suspended With pay because the lab's performance did not. Improve aftelward, a DPS spolcesperson Ald. But Alejandro •AJex" Madrigal, who was In c:harva of the McAllen DNA lab until his Feb. 24 suspension, sars· he never received any retraining and believes he was suspended beawse he contested many rl the findings of the DPS team that Inspected his lab. Madrlgal,.a 14-year Yet:eran of the lab, says he expects to be ftted soon. His sftultfon could atrect 1 murder b111 sdleduled to begin next week In Hidalgo Caunty, one of the South Texas counties served by the McAllen DPS crtme lab. Statawlde DPS crtma lab Chief Ron Urbanovsky CDulcl not be ...-ched for comment:. The McAllen DNA lab was shuttared from June 16 to Sept. 26. DPS auditors cited nurner'QUS problems that led to the closure: • Sexual assault kits awaltlno analysis were not property sealed. • Chemical reagents used In DNA tests were not property labeled and one had expired. • The sensitMtY of the lnstr'lllllent used tD determine DNA praftles was not established befOre doing casework on evidence. • A chemical In I DNA test ldt used to assign tile Identity of genetic marlcets In case samples was · reused In violation of staftdarct operating procedures. . • Samplel that pve no DNA proftles were not documented; • 'Tlle cllsJ)OSit!On of evidence was not property reported. The OWonfda obtained a ccpy of the McAllen report. dated July 23, 2003, after requesting copies of aD DPS lab audits pe1 fa mad last year. However, the McAllen report was not InclUded In the original group of documents sent to the ChroniCle. Asked about the omission, DPS senior assistant general c:ounsef Pamela SmJtJt Slid she was not sure whether the report had been completed. . The stat!! agency did not provide the Chronlde with a c0py of the McAllen audit until the newspaper's atmmey, Joseph I.Jirsan, threatened tD fila 1 a:nnplalnt w1ttt the Texas Attxmey General's O!fice. · 1n an Interview at his attorney's offlc% last weet. the suspended lab dllef, Madrigal, ·.----:~"!"::~*~*~~1 DPS secretly shuttered DNA: I Chron.com ·Houston Chronicle Pagefor3 edcnowledged tile problems reported by the CPS audltots, but did not agree on their severity. He also maintained that. after most audits, CPS lab workers are given a d\anc:e tD correct tJ\e flaws. ~ example, the temperature In the refrloeralm" (where rape kits are SIDred) Is 40 degrees.• .··:" Madrigal said. -sometimes a seat becOmes br1Uie and brealcs off. We go bact 111d reseal tJ\em. USU&Dy, the auditorS Just do 1 raw random chedcs. Tills t1me they were detl!nnlned tD find · ..:. something because they emptied the refrfgerator.• A DPS analyst not bMIIved ·1n the audit Slid tbat. WhUe most of the problems cited by the ludltDrs 111"1 not crftkal, the tallunt of McAllen analysts tD know the sensltJ'IIty of the Instrument used tD deblrmlne DNA praflles awfd haw lad tD faulty test results. .• ·. "'f you don't know the sensitivity d the Instrument you're using, then you're just guessing (about the resultS),• said the DNA analyst. who spoke tD the Olronlde on the condition ot anonymity. However, Madrtgal said the 1ntama1 audit did not consider the fact tflat the McAllen lab was using - and had been giVen permission tD use - an older pmtocDI than the one the agency currently uses with regard tD the Instrument. ·· '"ThlS Is not 1 valid (audit) llndlng bec:ause we went .under the old SOP (standard operating procedure),• safd MadltQal. "''bey wttre bylng tD force us to use the new SOP, but • were . grandtatheted because our Instruments were (old).• Madrigal alSo paints out that irom1,999 thravgh 2002 his per1onnaftce evaluatlolis noted tMi his lcnowfedge of h~ Job a:ceedftll the stiUidenls of the department. / If, as Madrigal assumes, lie Is fired soon, that a:~~~ld pose prdllems ror prosecutDrs In a Hidalgo County murder Cllll! set for. trfal next week. Juan Tosasdo, a convicted dluo dealer, Is charged with the 1993 slaying d L.erar ~ · Aa:Drdlng tD Assistant Dlstrkt Attorney William Mc:Ptlerson, DNA analysis of the Ylctlm's blOod found In the susPeCt's house and car wiD play a large role In the prosecutton, although It wiD not be Md'herlan's only evidence. Much of the DNA evlderic:e In the case was processed by MadttgaL Howevei', until ~My were cantaclled by the Omlnlde, neither Mc:Phelson nor hiS bOss, Dlstrkt .At1:DrneV Rene Guerra, knew about the closure of the McAllen lab, the review of evidence analyzed there or Madr1gal's suspension. "''ve not heard tflat and I would want tD know about that,• McPhtnan Said. •Aftd, apparently (beCause of) What you're brtngJno tD my auentton, ·rm going tD t1eve tD call tt1e head {of the lab) OYCr ttlere ·- (beclnise) we weien't natffted.• . DPS spolceswoman Tela Mange Slid that durtng ttle tbNe-marittl clo!An, wortt that normally would have been handled by the McADen DNA lab wei sent tD other DPS labs around the state. Madrigal says that he and .ottler lab woricers ~-tDid tD tell Jaw enfon:ement offidals that the ·... wor1e was being dlvertl!ld tD other labs because or a bacldOiD at the Mc'AIIen lab, not because It was dOSed. Adclmonafly, When nrst contadl!d a11out the McAllen slbJatlon, Mange said she had understDod that the audit anc:tleb Closure had resulted In the review of only about 100 cases. However, when tDtd ot Madrl;al's estimate.. that about 300 had been sc:riltSnlzed, Mange adci\owledged that he CIOUid be correct. ~ey may be going bade 1116 nMi!wlng eddlltonal cases a pa:t of the lntemallnVestlgatton, • she said. Mange also conf,nned that the DPS did not notify most law enfomlment officials who do business Wltlr the McAIJen lab about the problemS tt1ere. "' think (we) may have contacted one of ttle prosecutors, but none ot lhe things that we have found would change or affect the out=ne of any cases,• she Sllld. But aa:ordlng tD the Immediate past president of the Harris Caunty Criminal Defense Lawyers Association. the DPS had a duty tD notify everyone lnvalved witMIIe cases. · '"1lley'Ye GOt a Cllt15tltuUOnaJ duty tD dlsdose ttuit lntotmatlon CtD the ctefenclant),• said HoustDn attorney Troy MdCinney. •Anyone. who had a case In the betl:h that they went reviewing, anyone who had an ongOing case, was constftulklnally enUtfed to know INt.• Jndeed, one loc:8l detecttve, Who asbd nOt tD be ldentlfted, Aid lew tflou:ement officials also would haW wanted tD be Informed abOut the situation.• "Jtts Jllce asfdng, If 1 had cancer, would I want tD knOw aboUt It, • said the law offlcer. • ot course I would, so I could do something about it.• VOICD 011110UA081 Readers are solely responsible far the mntent of the comments they post hen!. .Comments are .subject to the sb'a terms and c::ondltlonl of use and do not neceaarlly reftect the optnlon or 8PJ"'Vaa of ttle HoustDn Oltonfde. NCADP: National Coalition to Abolish the Death Penalty Page 1 o / .... NIWI MIADLINI ~S: Oii'S SK.~~y CLOS!D C~A t...\3- S!Z..ATOR ~OU!l£• SY LACC< M TIUt<dS<iJAi:tEHCY MARCH 15.. 2C04 -, 1awma11et 'llflo!all,.., .:.,... oliN stafll agency'S 019*19 SCNtlny d i1l own lab, and ils cfedsbt to lleep QUW iltlcd the proe., dislLwtled a Gil spDJ-ed leglillalian regulllllng publll: DNA labaaiDfes. "1t mPI8s you wa*f If they are capatlle d nn*lg I and wfllrtller 01 IICII tlloly're gMng u.IUik1bmafbt,• said Rep. Kevil Bay, D-HauiiDt. [ Jain OUr l-tMII List ) In niSpllll8e 1D IN cta.n d DNA lalla k1 Hausbl and Fort Worth willlln rnantt. o1 acta ot1W last year, Baiay, IN d\Umlln oliN Houle Comnillee on General ~lil~g. sponiiGnld a law recpnng tNI al pubic DNA labs In the lltiltll be aa:redillld "'Septanber 2005. 1lle law abo glwal the CPS respallibility far~ INt ptOC8IL But now a frustratad ~ wenden If 1M ag~~~ey II up to lhetasiL / . "Wffre Pig to !lave to taM I hard took at CPS,• he said. , clon1 la1GW If lhey're nat dcint their job pn:lpeffr 01 lfleyre trylr to hide lnlbrmalion. 11 gaee badl to IN old luueltlat people's lives - at stake and no one -..tD ClfW.• ·Tile McAllen DNA laiiW811 leilipOi&il'f c:laeed alliW anlntllmal pertaimaaiCI audll upoaed a nuiftl)ar o1 prob...,._ The s11111 waal'lllnlined during 1118 shu1dowll, but die IIUd d die lab Ills bea1 suspended wilh paJ bec.ause the lab'a P8i IDIITIIIICI d not lll1pla¥e aftrM:.Id. a CPS~ said. Bul Alejandla "NU' Madrigal, who was k1 dlarge ollfle McAllen DNA lab untll'lll FeD. 24 -pension. says h e " - received my retr.lillrlg and believes he was suspended because he c:anlllsCed many d die llndk1p of 1M CPS team 1t1at lnspKfed Ilia lab. Madrigal, a t4-,..- w111ran althe lab, says I'll apecta ID lllllnld soon. H'- situdon a:uld atr.ct a munfer trta1 sdleduled to bllgD nat weellln Hidalgo Cauntr, one al 1M South Taus counties UM!Id bJ die McAllen DPS crtmelab. · Statawlde CPS Clime lab c:tlilf Ran UrtlancMky cculd IICIIIII readied far camment. The McAllen DNA lab waa sllullilred l'ron'l J\irle 18 to Sept. 28. DPS auditors cited numetOUa ~ 1t1at led to the ctosur.: - ..
6 Based on my education, training and experience, and my review of this material, it is my opinion to a reasonable degree of medical certainty that • OCHOA's testimony was misleading and inaccurate • His testing involved the analysis of nine loci on DNA recovered from the victim, suspect and scene materials; on some of the material, three loci .. tested similar to the suspect and victim but not the other six. This does not, as he testified to, qualify as a "match". • Current standards, and those utilized by the Federal Bureau of Investigation, require that 13 loci be used and that all 13 must match between the two samples to call it a "match" • Thusly, his inaccurate testimony did not meet the requirements of forensic science in 2001 and forensic science now knows for certain that those samples would not be matched to Gustavo Mireles.
7 I am not being reimbursed in any manner for rendering this opinion. I declare under penalty of perjury under the laws of the State of California that the foregoing is tnte and correct. -~~ Executedthis /L_ day of February 2014 in San Diego, California. 1'~ HARRY J. BO ELL, M.D.
11 The databank hit occurs in reasonably close "making sense" on the basis of analytical data. proximity to the alleged incident; however, When this occurs, unless agency policy states } other pending prosecutions against the defen- otherwise, no hit report will be issued by the dant delay ability of the prosecution to initiate casework lab; however, all information regarding the case at hand. li. the comparison and disposition df the hit will be maintained in the corresponding case file. When This section covers some of the concerns and the labs determine. on the basis~:f their review, opportunities for defense attorneys dealing with that the analytical data support t e hit, a similar these increasingly common "cold hit" cases. process to the one noted above s followed by the offender lab to research, con irm and share offender information with the ca$ework lab. How to approach a COD IS or cold hit case: The basics When a DNA profile in the forensic index match- es another profile in the forensic index, crime A "cold hit" case is generally like a "normal" scenes can be linked together. COOlS hits involv- DNA case, except that the government may have ing two casework profiles will still go through a little to go on, other than the cold hit. Defense verification process. If both labs are in agreement counsel can still use the typical defense theories that the profiles match, both casework labs will that do not involve challenging the DNA evi- typically provide hit reports to the corresponding dence, such as consent, or fabrication or plant- investigating agencies. These hits enable inves- ing of evidence. Of course, sometimes such a tigators to identify repeat offend~rs. coordinate defense is not the best option. In those cases.